Cart 51 Product Products 8 210,80 € (empty)
-
1 x TNFSF14-tu...113,40 € -
1 x PDZK1IP1-P...113,40 € -
1 x CXCL10-che...113,40 € -
1 x KIAA1305-K...113,40 € -
1 x MCFD2-mult...113,40 € -
1 x WFDC5-WAP...113,40 € -
1 x NDFIP1-Ned...113,40 € -
1 x DNASE1-deo...121,50 € -
-
-
-
1 x TAF1D-TATA...121,50 € -
1 x JTV1-JTV1...121,50 € -
1 x MGC14425-h...113,40 € -
1 x MCTS1-mali...113,40 € -
1 x IMP3-IMP3,...113,40 € -
1 x SOCS4-supp...121,50 € -
1 x IL20RB-int...121,50 € -
-
1 x PEF1-penta...121,50 € -
1 x PPIA-pepti...113,40 € -
1 x PECI-perox...121,50 € -
1 x MAPK8IP2-m...121,50 € -
-
1 x TCTN3-tect...121,50 € -
1 x PMVK-phosp...113,40 € -
1 x METTL8-met...113,40 € -
-
-
-
-
1 x CXCL3-chem...113,40 € -
1 x AQP5-aquap...113,40 € -
1 x MDS1-myelo...113,40 € -
1 x JMJD2B-jum...121,50 € -
-
-
-
1 x OLFML3-olf...121,50 € -
1 x MEF2A-myoc...121,50 € -
1 x TMPRSS5-tr...121,50 € -
-
1 x GBAP-gluco...121,50 € -
1 x BEND5-BEN...121,50 € -
1 x PPCDC-phos...113,40 € -
1 x ODC1-ornit...121,50 € -
-
1 x FGFRL1-fib...121,50 € -
-
1 x APEX1-APEX...121,50 € -
No products
To be determined Shipping
8 210,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 51 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 8 210,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 8 210,80 €
View larger 
Data sheet of AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015503 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGR2 |
| Origin species: | Human |
| Product name: | AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC015503 |
| Gene id: | 10551 |
| Gene description: | anterior gradient homolog 2 (Xenopus laevis) |
| Synonyms: | AG2; GOB-4; HAG-2; HEL-S-116; PDIA17; XAG-2; anterior gradient protein 2 homolog; AG-2; HPC8; anterior gradient homolog 2; epididymis secretory protein Li 116; protein disulfide isomerase family A, member 17; secreted cement gland homolog; secreted cement gland protein XAG-2 homolog; anterior gradient 2, protein disulphide isomerase family member |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaaattccagtgtcagcattcttgctccttgtggccctctcctacactctggccagagataccacagtcaaacctggagccaaaaaggacacaaaggactctcgacccaaactgccccagaccctctccagaggttggggtgaccaactcatctggactcagacatatgaagaagctctatataaatccaagacaagcaacaaacccttgatgattattcatcacttggatgagtgcccacacagtcaagctttaaagaaagtgtttgctgaaaataaagaaatccagaaattggcagagcagtttgtcctcctcaatctggtttatgaaacaactgacaaacacctttctcctgatggccagtatgtccccaggattatgtttgttgacccatctctgacagttagagccgatatcactggaagatattcaaaccgtctctatgcttacgaacctgcagatacagctctgttgcttgacaacatgaagaaagctctcaagttgctgaagactgaattgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2F (putative) - non-metastatic cells 4, protein expressed in - non-metastatic cells 4, protein expressed in - eukaryotic translation initiation factor 4E |