AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene View larger

AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015503
Product type: DNA & cDNA
Ncbi symbol: AGR2
Origin species: Human
Product name: AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene
Size: 2ug
Accessions: BC015503
Gene id: 10551
Gene description: anterior gradient homolog 2 (Xenopus laevis)
Synonyms: AG2; GOB-4; HAG-2; HEL-S-116; PDIA17; XAG-2; anterior gradient protein 2 homolog; AG-2; HPC8; anterior gradient homolog 2; epididymis secretory protein Li 116; protein disulfide isomerase family A, member 17; secreted cement gland homolog; secreted cement gland protein XAG-2 homolog; anterior gradient 2, protein disulphide isomerase family member
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaaattccagtgtcagcattcttgctccttgtggccctctcctacactctggccagagataccacagtcaaacctggagccaaaaaggacacaaaggactctcgacccaaactgccccagaccctctccagaggttggggtgaccaactcatctggactcagacatatgaagaagctctatataaatccaagacaagcaacaaacccttgatgattattcatcacttggatgagtgcccacacagtcaagctttaaagaaagtgtttgctgaaaataaagaaatccagaaattggcagagcagtttgtcctcctcaatctggtttatgaaacaactgacaaacacctttctcctgatggccagtatgtccccaggattatgtttgttgacccatctctgacagttagagccgatatcactggaagatattcaaaccgtctctatgcttacgaacctgcagatacagctctgttgcttgacaacatgaagaaagctctcaagttgctgaagactgaattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2F (putative)
- non-metastatic cells 4, protein expressed in
- non-metastatic cells 4, protein expressed in
- eukaryotic translation initiation factor 4E

Buy AGR2-anterior gradient homolog 2 (Xenopus laevis) Gene now

Add to cart