ACBD7-acyl-Coenzyme A binding domain containing 7 Gene View larger

ACBD7-acyl-Coenzyme A binding domain containing 7 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACBD7-acyl-Coenzyme A binding domain containing 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACBD7-acyl-Coenzyme A binding domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029526
Product type: DNA & cDNA
Ncbi symbol: ACBD7
Origin species: Human
Product name: ACBD7-acyl-Coenzyme A binding domain containing 7 Gene
Size: 2ug
Accessions: BC029526
Gene id: 414149
Gene description: acyl-Coenzyme A binding domain containing 7
Synonyms: bA455B2.2; acyl-CoA-binding domain-containing protein 7; acyl-Coenzyme A binding domain containing 7; acyl-CoA binding domain containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgcaggctgattttgacagggctgcagaagatgtgaggaagctgaaagcaagaccagatgatggagaactgaaagaactctatgggctttacaaacaagcaatagttggagacattaatattgcgtgtccaggaatgctagatttgaaaggcaaagccaaatgggaagcatggaacctcaaaaaagggttgtcgacggaagatgcgacgagtgcctatatttctaaagcaaaggagctgatagaaaaatacggaatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TRAF family member-associated NFKB activator
- Morf4 family associated protein 1-like 1
- CD59 molecule, complement regulatory protein
- ubiquitin-fold modifier conjugating enzyme 1

Buy ACBD7-acyl-Coenzyme A binding domain containing 7 Gene now

Add to cart