HTR3A-5-hydroxytryptamine (serotonin) receptor 3A Gene View larger

HTR3A-5-hydroxytryptamine (serotonin) receptor 3A Gene

PTXBC002354

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HTR3A-5-hydroxytryptamine (serotonin) receptor 3A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HTR3A-5-hydroxytryptamine (serotonin) receptor 3A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002354
Product type: DNA & cDNA
Ncbi symbol: HTR3A
Origin species: Human
Product name: HTR3A-5-hydroxytryptamine (serotonin) receptor 3A Gene
Size: 2ug
Accessions: BC002354
Gene id: 3359
Gene description: 5-hydroxytryptamine (serotonin) receptor 3A
Synonyms: 5-HT-3; 5-HT3A; 5-HT3R; 5HT3R; HTR3; 5-hydroxytryptamine receptor 3A; 5-HT3-A; 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic; 5-hydroxytryptamine receptor 3; 5HT3 serotonin receptor; serotonin receptor 3A; serotonin-gated ion channel receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgtgggtccagcaggcgctgctcgccttgctcctccccacactcctggcacagggagaagccaggaggagccgaaacaccaccaggcccgctctgctgaggctgtcggattaccttttgaccaactacaggaagggtgtgcgccccgtgagggactggaggaagccaaccaccgtatccattgacgtcattgtctatgccatcctcaacgtggatgagaagaatcaggtgctgaccacctacatctggtaccggcagtactggactgatgagtttctccagtggaaccctgaggactttgacaacatcaccaagttgtccatccccacggacagcatctgggtcccggacattctcatcaatgagttcgtggatgtggggaagtctccaaatatcccgtacgtgtatattcggcatcaaggcgaagttcagaactacaagccccttcaggtggtgactgcctgtagcctcgacatctacaacttccccttcgatgtccagaactgctcgctgaccttcaccagttggctgcacaccatccaggacatcaacatctctttgtggcgcttgccagaaaaggtgaaatccgacaggagtgtcttcatgaaccagggagagtgggagttgctgggggtgctgccctactttcgggagttcagcatggaaagcagtaactactatgcagaaatgaagttctatgtggtcatccgccggcggcccctcttctatgtggtcagcctgctactgcccagcatcttcctcatggtcatggacatcgtgggcttctacctgccccccaacagtggcgagagggtctctttcaagattacactcctcctgggctactcggtcttcctgatcatcgtttctgacacgctgccggccactgccatcggcactcctctcattggtgtctactttgtggtgtgcatggctctgctggtgataagtttggccgagaccatcttcattgtgcggctggtgcacaagcaagacctgcagcagcccgtgcctgcttggctgcgtcacctggttctggagagaatcgcctggctactttgcctgagggagcagtcaacttcccagaggcccccagccacctcccaagccaccaagactgatgactgctcagccatgggaaaccactgcagccacatgggaggaccccaggacttcgagaagagcccgagggacagatgtagccctcccccaccacctcgggaggcctcgctggcggtgtgtgggctgctgcaggagctgtcctccatccggcaattcctggaaaagcgggatgagatccgagaggtggcccgagactggctgcgcgtgggctccgtgctggacaagctgctattccacatttacctgctggcggtgctggcctacagcatcaccctggttatgctctggtccatctggcagtacgcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - debranching enzyme homolog 1 (S. cerevisiae)
- elongation factor 1 homolog (S. cerevisiae)
- acyl-Coenzyme A binding domain containing 7
- TRAF family member-associated NFKB activator

Buy HTR3A-5-hydroxytryptamine (serotonin) receptor 3A Gene now

Add to cart