CALCOCO2-calcium binding and coiled-coil domain 2 Gene View larger

CALCOCO2-calcium binding and coiled-coil domain 2 Gene

PTXBC004130

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALCOCO2-calcium binding and coiled-coil domain 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CALCOCO2-calcium binding and coiled-coil domain 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004130
Product type: DNA & cDNA
Ncbi symbol: CALCOCO2
Origin species: Human
Product name: CALCOCO2-calcium binding and coiled-coil domain 2 Gene
Size: 2ug
Accessions: BC004130
Gene id: 10241
Gene description: calcium binding and coiled-coil domain 2
Synonyms: NDP52; calcium-binding and coiled-coil domain-containing protein 2; antigen nuclear dot 52 kDa protein; nuclear domain 10 protein 52; nuclear domain 10 protein NDP52; nuclear dot protein 52; calcium binding and coiled-coil domain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagaccatcaaagatccccccacatcagctgtcttgctggatcactgtcatttctctcaggtcatctttaacagtgtggagaagttctacatccctggaggggacgtcacatgtcattataccttcacccagcatttcatccctcgtcgaaaggattggattggcatctttagagtggggtggaagacaacccgtgagtattacaccttcatgtgggttactttgcccattgacctaaacaacaaatcagctaaacagcaggaagtccaattcaaagcttactacctgcccaaggatgatgagtattaccagttctgctatgtggatgaggatggtgtggtccggggagcaagtattcctttccaattccgtccagaaaatgaggaagacatcctggttgttaccactcagggagaggtggaagagattgagcagcacaacaaggagctttgcaaagaaaaccaggagctgaaggacagctgtatcagcctccagaagcagaactcagacatgcaggctgagctccaaaagaagcaggaggagctagaaaccctacagagcatcaataagaagttggaactgaaagtgaaagaacagaaggactattgggagacagagctgcttcaactgaaagaacaaaaccagaagatgtcctcagaaaatgagaagatgggaatcagagtggatcagcttcaggcccagctgtcaactcaagagaaagaaatggagaagcttgttcagggagatcaagataagacagagcagttagagcagctgaaaaaggaaaatgaccacctctttctcagtttagctgaacagaggaaggaccagaagaagctcgagcagacagtggagcaaatgaagcagaatgaaactactgcaatgaagaaacaacaggaattaatggatgaaaactttgacctgtcaaaaagactgagtgagaacgaaattatatgtaatgctctgcagagacagaaagagagattggaaggagaaaatgatcttttgaagagggagaacagcagattgctcagttacatgggtctggattttaattctttgccgtatcaagtacctacttcagatgaaggaggcgcaagacaaaatccaggacttgcctatggaaacccatattctggtatccaagaaagttcttcccccagcccgctctccatcaagaaatgccctatctgcaaagcagatgatatttgtgatcacaccttggagcaacagcagatgcagcccctttgtttcaattgtccaatttgtgacaagatcttcccagctacagagaagcagatctttgaagaccacgtgttctgccactctctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 5-hydroxytryptamine (serotonin) receptor 3A
- debranching enzyme homolog 1 (S. cerevisiae)
- elongation factor 1 homolog (S. cerevisiae)
- acyl-Coenzyme A binding domain containing 7

Buy CALCOCO2-calcium binding and coiled-coil domain 2 Gene now

Add to cart