MEST-mesoderm specific transcript homolog (mouse) Gene View larger

MEST-mesoderm specific transcript homolog (mouse) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEST-mesoderm specific transcript homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MEST-mesoderm specific transcript homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002413
Product type: DNA & cDNA
Ncbi symbol: MEST
Origin species: Human
Product name: MEST-mesoderm specific transcript homolog (mouse) Gene
Size: 2ug
Accessions: BC002413
Gene id: 4232
Gene description: mesoderm specific transcript homolog (mouse)
Synonyms: PEG1; mesoderm-specific transcript homolog protein; paternally-expressed gene 1 protein; mesoderm specific transcript
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcgccgagatcgcctccgcaggatgagggagtggtgggtccaggtggggctgctggccgtgcccctgcttgctgcgtacctgcacatcccaccccctcagctctcccctgcccttcactcatggaagtcttcaggcaagtttttcacttacaagggactgcgtatcttctaccaagactctgtgggtgtggttggaagtccagagatagttgtgcttttacacggttttccaacatccagctacgactggtacaagatttgggaaggtctgaccttgaggtttcatcgggtgattgcccttgatttcttaggctttggcttcagtgacaaaccgagaccacatcactattccatatttgagcaggccagcatcgtggaagcgcttttgcggcatctggggctccagaaccgcaggatcaaccttctttctcatgactatggagatattgttgctcaggagcttctctacaggtacaagcagaatcgatctggtcggcttaccataaagagtctctgtctgtcaaatggaggtatctttcctgagactcaccgtccactccttctccaaaagctactcaaagatggaggtgtgctgtcacccatcctcacacgactgatgaacttctttgtattctctcgaggtctcaccccagtctttgggccgtatactcggccctctgagagtgagctgtgggacatgtgggcagggatccgcaacaatgacgggaacttagtcattgacagtctcttacagtacatcaatcagaggaagaagttcagaaggcgctgggtgggagctcttgcctctgtaactatccccattcattttatctatgggccattggatcctgtaaatccctatccagagtttttggagctgtacaggaaaacgctgccgcggtccacagtgtcgattctggatgaccacattagccactatccacagctagaggatcccatgggcttcttgaatgcatatatgggcttcatcaactccttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proline-rich cyclin A1-interacting protein
- NAD(P) dependent steroid dehydrogenase-like
- RAB3A interacting protein (rabin3)-like 1
- CD46 molecule, complement regulatory protein

Buy MEST-mesoderm specific transcript homolog (mouse) Gene now

Add to cart