Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DUSP26-dual specificity phosphatase 26 (putative) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP26-dual specificity phosphatase 26 (putative) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP26 |
| Origin species: | Human |
| Product name: | DUSP26-dual specificity phosphatase 26 (putative) Gene |
| Size: | 2ug |
| Accessions: | BC001613 |
| Gene id: | 78986 |
| Gene description: | dual specificity phosphatase 26 (putative) |
| Synonyms: | DSP-4; DUSP24; LDP-4; MKP-8; MKP8; NATA1; NEAP; SKRP3; dual specificity protein phosphatase 26; MAP kinase phosphatase 8; Novel amplified gene in thyroid anaplastic cancer; dual specificity phosphatase 26 (putative); dual specificity phosphatase SKRP3; low-molecular-mass dual-specificity phosphatase 4; mitogen-activated protein kinase phosphatase 8; neuroendocrine-associated phosphatase; dual specificity phosphatase 26 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgccctggtaactggctttgggcttctatgacttttatggcccgcttctcccggagtagctcaaggtctcctgttcgaactcgagggaccctggaggagatgccaaccgttcaacatcctttcctcaatgtcttcgagttggagcggctcctctacacaggcaagacagcctgtaaccatgccgacgaggtctggccaggcctctatctcggagaccaggacatggctaacaaccgccgggagcttcgccgcctgggcatcacgcacgtcctcaatgcctcacacagccggtggcgaggcacgcccgaggcctatgaggggctgggcatccgctacctgggtgttgaggcccacgactcgccagcctttgacatgagcatccacttccagacggctgccgacttcatccaccgggcgctgagccagccaggagggaagatcctggtgcattgtgctgtgggcgtgagccgatccgccaccctggtactggcctacctcatgctgtaccaccaccttaccctcgtggaggccatcaagaaagtcaaagaccaccgaggcatcatccccaaccggggcttcctgaggcagctcctggccctggaccgcaggctgcggcagggtctggaagcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibroblast growth factor binding protein 1 - phosphatidylethanolamine N-methyltransferase - mesoderm specific transcript homolog (mouse) - proline-rich cyclin A1-interacting protein |