DUSP26-dual specificity phosphatase 26 (putative) Gene View larger

DUSP26-dual specificity phosphatase 26 (putative) Gene

PTXBC001613

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP26-dual specificity phosphatase 26 (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP26-dual specificity phosphatase 26 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001613
Product type: DNA & cDNA
Ncbi symbol: DUSP26
Origin species: Human
Product name: DUSP26-dual specificity phosphatase 26 (putative) Gene
Size: 2ug
Accessions: BC001613
Gene id: 78986
Gene description: dual specificity phosphatase 26 (putative)
Synonyms: DSP-4; DUSP24; LDP-4; MKP-8; MKP8; NATA1; NEAP; SKRP3; dual specificity protein phosphatase 26; MAP kinase phosphatase 8; Novel amplified gene in thyroid anaplastic cancer; dual specificity phosphatase 26 (putative); dual specificity phosphatase SKRP3; low-molecular-mass dual-specificity phosphatase 4; mitogen-activated protein kinase phosphatase 8; neuroendocrine-associated phosphatase; dual specificity phosphatase 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgccctggtaactggctttgggcttctatgacttttatggcccgcttctcccggagtagctcaaggtctcctgttcgaactcgagggaccctggaggagatgccaaccgttcaacatcctttcctcaatgtcttcgagttggagcggctcctctacacaggcaagacagcctgtaaccatgccgacgaggtctggccaggcctctatctcggagaccaggacatggctaacaaccgccgggagcttcgccgcctgggcatcacgcacgtcctcaatgcctcacacagccggtggcgaggcacgcccgaggcctatgaggggctgggcatccgctacctgggtgttgaggcccacgactcgccagcctttgacatgagcatccacttccagacggctgccgacttcatccaccgggcgctgagccagccaggagggaagatcctggtgcattgtgctgtgggcgtgagccgatccgccaccctggtactggcctacctcatgctgtaccaccaccttaccctcgtggaggccatcaagaaagtcaaagaccaccgaggcatcatccccaaccggggcttcctgaggcagctcctggccctggaccgcaggctgcggcagggtctggaagcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor binding protein 1
- phosphatidylethanolamine N-methyltransferase
- mesoderm specific transcript homolog (mouse)
- proline-rich cyclin A1-interacting protein

Buy DUSP26-dual specificity phosphatase 26 (putative) Gene now

Add to cart