SERPINA1-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 Gene View larger

SERPINA1-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINA1-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINA1-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011991
Product type: DNA & cDNA
Ncbi symbol: SERPINA1
Origin species: Human
Product name: SERPINA1-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 Gene
Size: 2ug
Accessions: BC011991
Gene id: 5265
Gene description: serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
Synonyms: A1A; A1AT; AAT; PI1; PRO2275; alpha1AT; alpha-1-antitrypsin; alpha-1 antitrypsin; alpha-1 protease inhibitor; alpha-1-antiproteinase; alpha-1-antitrypsin null; protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin; serine (or cysteine) proteinase inhibitor, clade A, member 1; serpin A1; serpin peptidase inhibitor clade A member 1; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1; serpin family A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtcttctgtctcgtggggcatcctcctgctggcaggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccagaagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaacctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaatatcttcttctccccagtgagcatcgctacagcctttgcaatgctctccctggggaccaaggctgacactcacgatgaaatcctggagggcctgaatttcaacctcacggagattccggaggctcagatccatgaaggcttccaggaactcctccgtaccctcaaccagccagacagccagctccagctgaccaccggcaatggcttgttcctcagcgagggcctgaagctagtggataagtttttggaggatgttaaaaagttgtaccactcagaagccttcactgtcaacttcggggacaccgaagaggccaagaaacagatcaacgattacgtggagaagggtactcaagggaaaattgtggatttggtcaaggagcttgacagagacacagtttttgctctggtgaattacatcttctttaaaggcaaatgggagagaccctttgaagtcaaggacaccgaggaagaggacttccacgtggaccaggtgaccaccgtgaaggtgcctatgatgaagcgtttaggcatgtttaacatccagcactgtaagaagctgtccagctgggtgctgctgatgaaatacctgggcaatgccaccgccatcttcttcctgcctgatgaggggaaactacagcacctggaaaatgaactcacccacgatatcatcaccaagttcctggaaaatgaagacagaaggtctgccagcttacatttacccaaactgtccattactggaacctatgatctgaagagcgtcctgggtcaactgggcatcactaaggtcttcagcaatggggctgacctctccggggtcacagaggaggcacccctgaagctctccaaggccgtgcataaggctgtgctgaccatcgacgagaaagggactgaagctgctggggccatgtttttagaggccatacccatgtctatcccccccgaggtcaagttcaacaaaccctttgtcttcttaatgattgaccaaaataccaagtctcccctcttcatgggaaaagtggtgaatcccacccaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
- asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
- ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4

Buy SERPINA1-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 Gene now

Add to cart