Login to display prices
Login to display prices
C14orf100-chromosome 14 open reading frame 100 Gene View larger

C14orf100-chromosome 14 open reading frame 100 Gene

PTXBC010359

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf100-chromosome 14 open reading frame 100 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf100-chromosome 14 open reading frame 100 Gene

Proteogenix catalog: PTXBC010359
Ncbi symbol: C14orf100
Product name: C14orf100-chromosome 14 open reading frame 100 Gene
Size: 2ug
Accessions: BC010359
Gene id: 51528
Gene description: chromosome 14 open reading frame 100
Synonyms: C14orf100; CDA06; HSPC213; HSPC327; JAMP; JNK1/MAPK8-associated membrane protein; JNK-associated membrane protein; Jun N-terminal kinase 1-associated membrane protein; medulloblastoma antigen MU-MB-50.4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtcgatattcaaccagcatgccttggactttattgtgggaagaccctattatttaaaaatggctcaactgaaatatatggagaatgtggggtatgcccaagaggacagagaacgaatgcacagaaatattgtcagccttgcacagaatctcctgaactttatgattggctctatcttggatttatggcaatgcttcctctggttttacattggttcttcattgaatggtactcggggaaaaagagttccagcgcacttttccaacacatcactgcattatttgaatgcagcatggcagctattatcaccttacttgtgagtgatccagttggtgttctttatattcgttcatgtcgagtattgatgctttctgactggtacacgatgctttacaacccaagtccagattacgttaccacagtacactgtactcatgaagccgtctacccactatataccattgtatttatctattacgcattctgcttggtattaatgatgctgctccgacctcttctggtgaagaagattgcatgtgggttagggaaatctgatcgatttaaaagtatttatgctgcactttacttcttcccaattttaaccgtgcttcaggcagttggtggaggccttttatattacgccttcccatacattatattagtgttatctttggttactctggctgtgtacatgtctgcttctgaaatagagaactgctatgatcttctggtcagaaagaaaagacttattgttctcttcagccactggttacttcatgcctatggaataatctccatttccagagtggataaacttgagcaagatttgccccttttggctttggtacctacaccagcccttttttacttgttcactgcaaaatttaccgaaccttcaaggatactctcagaaggagccaatggacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: