Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C14orf100-chromosome 14 open reading frame 100 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C14orf100-chromosome 14 open reading frame 100 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010359 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C14orf100 |
| Origin species: | Human |
| Product name: | C14orf100-chromosome 14 open reading frame 100 Gene |
| Size: | 2ug |
| Accessions: | BC010359 |
| Gene id: | 51528 |
| Gene description: | chromosome 14 open reading frame 100 |
| Synonyms: | C14orf100; CDA06; HSPC213; HSPC327; JAMP; JNK1/MAPK8-associated membrane protein; JNK-associated membrane protein; Jun N-terminal kinase 1-associated membrane protein; medulloblastoma antigen MU-MB-50.4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtcgatattcaaccagcatgccttggactttattgtgggaagaccctattatttaaaaatggctcaactgaaatatatggagaatgtggggtatgcccaagaggacagagaacgaatgcacagaaatattgtcagccttgcacagaatctcctgaactttatgattggctctatcttggatttatggcaatgcttcctctggttttacattggttcttcattgaatggtactcggggaaaaagagttccagcgcacttttccaacacatcactgcattatttgaatgcagcatggcagctattatcaccttacttgtgagtgatccagttggtgttctttatattcgttcatgtcgagtattgatgctttctgactggtacacgatgctttacaacccaagtccagattacgttaccacagtacactgtactcatgaagccgtctacccactatataccattgtatttatctattacgcattctgcttggtattaatgatgctgctccgacctcttctggtgaagaagattgcatgtgggttagggaaatctgatcgatttaaaagtatttatgctgcactttacttcttcccaattttaaccgtgcttcaggcagttggtggaggccttttatattacgccttcccatacattatattagtgttatctttggttactctggctgtgtacatgtctgcttctgaaatagagaactgctatgatcttctggtcagaaagaaaagacttattgttctcttcagccactggttacttcatgcctatggaataatctccatttccagagtggataaacttgagcaagatttgccccttttggctttggtacctacaccagcccttttttacttgttcactgcaaaatttaccgaaccttcaaggatactctcagaaggagccaatggacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytokine induced apoptosis inhibitor 1 - polymerase (RNA) I polypeptide C, 30kDa - TRAF and TNF receptor associated protein - galactose-1-phosphate uridylyltransferase |