Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008863 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR1C |
| Origin species: | Human |
| Product name: | POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene |
| Size: | 2ug |
| Accessions: | BC008863 |
| Gene id: | 9533 |
| Gene description: | polymerase (RNA) I polypeptide C, 30kDa |
| Synonyms: | AC40; HLD11; RPA39; RPA40; RPA5; RPAC1; RPC40; TCS3; DNA-directed RNA polymerases I and III subunit RPAC1; DNA-directed RNA polymerase I subunit C; DNA-directed RNA polymerases I and III 40 kDa polypeptide; RNA polymerases I and III subunit AC1; polymerase (RNA) I polypeptide C; polymerase (RNA) I polypeptide C, 30kDa; polymerase (RNA) I subunit C; RNA polymerase I subunit C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcttctcaggcggtggaggaaatgcggagccgcgtggttctgggggagtttggggttcgcaatgtccatactactgactttcccggtaactattccggttatgatgatgcctgggaccaggaccgcttcgagaagaatttccgtgtggatgtagtacacatggatgaaaactcactggagtttgacatggtgggaattgacgcagccattgccaatgcttttcgacgaattctgctagctgaggtgccaactatggctgtggagaaggtcctggtgtacaataatacatccattgttcaggatgagattcttgctcaccgtctggggctcattcccattcatgctgatccccgtctttttgagtatcggaaccaaggagatgaagaaggcacagagatagatactctacagtttcgtctccaggtcagatgcactcggaacccccatgctgctaaagattcctctgaccccaacgaactgtacgtgaaccacaaagtgtataccaggcatatgacatggatccccctggggaaccaggctgatctctttccagagggcactatccgaccagtgcatgatgatatcctcatcgctcagctgcggcctggccaagaaattgacctgctcatgcactgtgtcaagggcattggcaaagatcatgccaagttttcaccagtggcaacagccagttacaggctcctgccagacatcaccctgcttgagcccgtggaaggggaggcagctgaggagttgagcaggtgcttctcacctggtgttattgaggtgcaggaagtccaaggtaaaaaggtggccagagttgccaacccccggctggataccttcagcagagaaatcttccggaatgagaagctaaagaaggttgtgaggcttgcccgggttcgagatcattatatcttctctgttgagtcaacgggggtgttgccaccagatgtgctggtgagtgaagccatcaaagtactgatggggaagtgccggcgcttcttggatgaactagatgcggttcagatggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TRAF and TNF receptor associated protein - galactose-1-phosphate uridylyltransferase - melanin-concentrating hormone receptor 1 - vasoactive intestinal peptide receptor 2 |