POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene View larger

POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene

PTXBC008863

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008863
Product type: DNA & cDNA
Ncbi symbol: POLR1C
Origin species: Human
Product name: POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene
Size: 2ug
Accessions: BC008863
Gene id: 9533
Gene description: polymerase (RNA) I polypeptide C, 30kDa
Synonyms: AC40; HLD11; RPA39; RPA40; RPA5; RPAC1; RPC40; TCS3; DNA-directed RNA polymerases I and III subunit RPAC1; DNA-directed RNA polymerase I subunit C; DNA-directed RNA polymerases I and III 40 kDa polypeptide; RNA polymerases I and III subunit AC1; polymerase (RNA) I polypeptide C; polymerase (RNA) I polypeptide C, 30kDa; polymerase (RNA) I subunit C; RNA polymerase I subunit C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcttctcaggcggtggaggaaatgcggagccgcgtggttctgggggagtttggggttcgcaatgtccatactactgactttcccggtaactattccggttatgatgatgcctgggaccaggaccgcttcgagaagaatttccgtgtggatgtagtacacatggatgaaaactcactggagtttgacatggtgggaattgacgcagccattgccaatgcttttcgacgaattctgctagctgaggtgccaactatggctgtggagaaggtcctggtgtacaataatacatccattgttcaggatgagattcttgctcaccgtctggggctcattcccattcatgctgatccccgtctttttgagtatcggaaccaaggagatgaagaaggcacagagatagatactctacagtttcgtctccaggtcagatgcactcggaacccccatgctgctaaagattcctctgaccccaacgaactgtacgtgaaccacaaagtgtataccaggcatatgacatggatccccctggggaaccaggctgatctctttccagagggcactatccgaccagtgcatgatgatatcctcatcgctcagctgcggcctggccaagaaattgacctgctcatgcactgtgtcaagggcattggcaaagatcatgccaagttttcaccagtggcaacagccagttacaggctcctgccagacatcaccctgcttgagcccgtggaaggggaggcagctgaggagttgagcaggtgcttctcacctggtgttattgaggtgcaggaagtccaaggtaaaaaggtggccagagttgccaacccccggctggataccttcagcagagaaatcttccggaatgagaagctaaagaaggttgtgaggcttgcccgggttcgagatcattatatcttctctgttgagtcaacgggggtgttgccaccagatgtgctggtgagtgaagccatcaaagtactgatggggaagtgccggcgcttcttggatgaactagatgcggttcagatggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TRAF and TNF receptor associated protein
- galactose-1-phosphate uridylyltransferase
- melanin-concentrating hormone receptor 1
- vasoactive intestinal peptide receptor 2

Buy POLR1C-polymerase (RNA) I polypeptide C, 30kDa Gene now

Add to cart