TTRAP-TRAF and TNF receptor associated protein Gene View larger

TTRAP-TRAF and TNF receptor associated protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTRAP-TRAF and TNF receptor associated protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TTRAP-TRAF and TNF receptor associated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017553
Product type: DNA & cDNA
Ncbi symbol: TTRAP
Origin species: Human
Product name: TTRAP-TRAF and TNF receptor associated protein Gene
Size: 2ug
Accessions: BC017553
Gene id: 51567
Gene description: TRAF and TNF receptor associated protein
Synonyms: TTRAP; AD022; EAP2; EAPII; dJ30M3.3; hTDP2; tyrosyl-DNA phosphodiesterase 2; 5'-Tyr-DNA phosphodiesterase; 5'-tyrosyl-DNA phosphodiesterase; ETS1-associated protein 2; ETS1-associated protein II; TRAF and TNF receptor-associated protein; VPg unlinkase; tyr-DNA phosphodiesterase 2; tyrosyl-RNA phosphodiesterase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttggggagttgcctggagggcgggagggaggcggcggaggaagagggcgagcctgaggtgaaaaagcggcgacttctgtgtgtggagtttgcctcggtcgcaagctgcgatgccgcagtggctcagtgcttcctggccgagaacgactgggagatggaaagggctctgaactcctacttcgagcctccggtggaggagagcgccttggaacgccgacctgaaaccatctctgagcccaagacctatgttgacctaaccaatgaagaaacaactgattccaccacttctaaaatcagcccatctgaagatactcagcaagaaaatggcagcatgttctctctcattacctggaatattgatggattagatctaaacaatctgtcagagagggctcgaggggtgtgttcctacttagctttgtacagcccagatgtgatatttctacaggaagttattcccccatattatagctacctaaagaagagatcaagtaattatgagattattacaggtcatgaagaaggatatttcacagctataatgttgaagaaatcaagagtgaaattaaaaagccaagagattattccttttccaagtaccaaaatgatgagaaaccttttatgtgtgcatgtgaatgtgtcaggaaatgagctttgccttatgacatcccatttggagagcaccagagggcatgctgcggaacgaatgaatcagttaaaaatggttttaaagaaaatgcaagaggctccagagtcagctacagttatatttgcaggagatacaaatctaagggatcgagaggttaccagatgtggtggtttacccaacaacattgtggatgtctgggagtttttgggcaaacctaaacattgccagtatacatgggatacacaaatgaactctaatcttggaataactgctgcttgtaaacttcgttttgatcgaatatttttcagagcagcagcagaagagggacacattattccccgaagtttggaccttcttggattagaaaaactggactgtggtagatttcctagtgatcactggggtcttctgtgcaacttagatataatattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - galactose-1-phosphate uridylyltransferase
- melanin-concentrating hormone receptor 1
- vasoactive intestinal peptide receptor 2
- chromosome 20 open reading frame 114

Buy TTRAP-TRAF and TNF receptor associated protein Gene now

Add to cart