C20orf114-chromosome 20 open reading frame 114 Gene View larger

C20orf114-chromosome 20 open reading frame 114 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf114-chromosome 20 open reading frame 114 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf114-chromosome 20 open reading frame 114 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008429
Product type: DNA & cDNA
Ncbi symbol: C20orf114
Origin species: Human
Product name: C20orf114-chromosome 20 open reading frame 114 Gene
Size: 2ug
Accessions: BC008429
Gene id: 92747
Gene description: chromosome 20 open reading frame 114
Synonyms: C20orf114; LPLUNC1; BPI fold-containing family B member 1; VEMSGP; long palate, lung and nasal epithelium carcinoma associated 1; long palate, lung and nasal epithelium carcinoma-associated protein 1; von Ebner minor salivary gland protein; BPI fold containing family B member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggcccgtggaccttcacccttctctgtggtttgctggcagccaccttgatccaagccaccctcagtcccactgcagttctcatcctcggcccaaaagtcatcaaagaaaagctgacacaggagctgaaggaccacaacgccaccagcatcctgcagcagctgccgctgctcagtgccatgcgggaaaagccagccggaggcatccctgtgctgggcagcctggtgaacaccgtcctgaagcacgtcatctggctgaaggtcatcacagctaacatcctccagctgcaggtgaagccctcggccaatgaccaggagctgctagtcaagatccccctggacatggtggctggattcaacacgcccctggtcaagaccatcgtggagttccacatgacgactgaggcccaagccaccatccgcatggacaccagtgcaagtggccccacccgcctggtcctcagtgactgtgccaccagccatgggagcctgcgcatccaactgctgcataagctctccttcctggtgaacgccttagctaagcaggtcatgaacctcctagtgccatccctgcccaatctagtgaaaaaccagctgtgtcccgtgatcgaggcttccttcaatggcatgtatgcagacctcctgcagctggtgaaggtgcccatttccctcagcattgaccgtctggagtttgaccttctgtatcctgccatcaagggtgacaccattcagctctacctgggggccaagttgttggactcacagggaaaggtgaccaagtggttcaataactctgcagcttccctgacaatgcccaccctggacaacatcccgttcagcctcatcgtgagtcaggacgtggtgaaagctgcagtggctgctgtgctctctccagaagaattcatggtcctgttggactctgtgcttcctgagagtgcccatcggctgaagtcaagcatcgggctgatcaatgaaaaggctgcagataagctgggatctacccagatcgtgaagatcctaactcaggacactcccgagttttttatagaccaaggccatgccaaggtggcccaactgatcgtgctggaagtgtttccctccagtgaagccctccgccctttgttcaccctgggcatcgaagccagctcggaagctcagttttacaccaaaggtgaccaacttatactcaacttgaataacatcagctctgatcggatccagctgatgaactctgggattggctggttccaacctgatgttctgaaaaacatcatcactgagatcatccactccatcctgctgccgaaccagaatggcaaattaagatctggggtcccagtgtcattggtgaaggccttgggattcgaggcagctgagtcctcactgagcaaggatgcccttgtgcttactccagcctccttgtggaaacccacctctcctgtctcccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arginyl-tRNA synthetase 2, mitochondrial
- acetylserotonin O-methyltransferase-like
- chromosome 17 open reading frame 101
- chromosome 14 open reading frame 128

Buy C20orf114-chromosome 20 open reading frame 114 Gene now

Add to cart