C17orf101-chromosome 17 open reading frame 101 Gene View larger

C17orf101-chromosome 17 open reading frame 101 Gene

PTXBC009297

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf101-chromosome 17 open reading frame 101 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf101-chromosome 17 open reading frame 101 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009297
Product type: DNA & cDNA
Ncbi symbol: C17orf101
Origin species: Human
Product name: C17orf101-chromosome 17 open reading frame 101 Gene
Size: 2ug
Accessions: BC009297
Gene id: 79701
Gene description: chromosome 17 open reading frame 101
Synonyms: PKHD domain-containing transmembrane protein C17orf101; C17orf101; 2-oxoglutarate and iron-dependent oxygenase domain-containing protein 3; 2-oxoglutarate and iron dependent oxygenase domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacctctctctcttctcctctcccaggtcgcgtctccttcttcacctcggggtccgagaacctacaccgcgtggagaaggtccactggggcacccgttacgccattaccatcgccttcagctgcaaccccgaccatggcatcgaggacccagcgttcccgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 128
- chromosome 14 open reading frame 147
- C-type lectin domain family 7, member A
- chromosome 20 open reading frame 107

Buy C17orf101-chromosome 17 open reading frame 101 Gene now

Add to cart