Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C20orf107-chromosome 20 open reading frame 107 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C20orf107-chromosome 20 open reading frame 107 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014951 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C20orf107 |
| Origin species: | Human |
| Product name: | C20orf107-chromosome 20 open reading frame 107 Gene |
| Size: | 2ug |
| Accessions: | BC014951 |
| Gene id: | 388799 |
| Gene description: | chromosome 20 open reading frame 107 |
| Synonyms: | uncharacterized protein C20orf107; C20orf107; dJ1153D9.4; protein FAM209B; family with sequence similarity 209 member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggacgctgaaatcgtccctggtcctgcttctgtgcctcacctgcagctatgcctttatgttctcttctctgagacagaaaactagcgaaccccaggggaaggtgccgtgtggagagcactttcggattcggcagaacctaccagagcacacccaaggctggcttgggagcaaatggctctggcttttgtttgctgttgtgccgtttgtgatactgaagtgtcaaagagacagtgagaagaataaggtaaggatggctccattttttttacaccatattgattcaatctcaggagtctcagggaaacggatgttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoprotein enriched in astrocytes 15 - chromosome 14 open reading frame 159 - cutC copper transporter homolog (E. coli) - transmembrane 4 L six family member 18 |