Login to display prices
Login to display prices
C20orf107-chromosome 20 open reading frame 107 Gene View larger

C20orf107-chromosome 20 open reading frame 107 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf107-chromosome 20 open reading frame 107 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf107-chromosome 20 open reading frame 107 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014951
Product type: DNA & cDNA
Ncbi symbol: C20orf107
Origin species: Human
Product name: C20orf107-chromosome 20 open reading frame 107 Gene
Size: 2ug
Accessions: BC014951
Gene id: 388799
Gene description: chromosome 20 open reading frame 107
Synonyms: uncharacterized protein C20orf107; C20orf107; dJ1153D9.4; protein FAM209B; family with sequence similarity 209 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggacgctgaaatcgtccctggtcctgcttctgtgcctcacctgcagctatgcctttatgttctcttctctgagacagaaaactagcgaaccccaggggaaggtgccgtgtggagagcactttcggattcggcagaacctaccagagcacacccaaggctggcttgggagcaaatggctctggcttttgtttgctgttgtgccgtttgtgatactgaagtgtcaaagagacagtgagaagaataaggtaaggatggctccattttttttacaccatattgattcaatctcaggagtctcagggaaacggatgttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoprotein enriched in astrocytes 15
- chromosome 14 open reading frame 159
- cutC copper transporter homolog (E. coli)
- transmembrane 4 L six family member 18