CUTC-cutC copper transporter homolog (E. coli) Gene View larger

CUTC-cutC copper transporter homolog (E. coli) Gene

PTXBC015059

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CUTC-cutC copper transporter homolog (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CUTC-cutC copper transporter homolog (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015059
Product type: DNA & cDNA
Ncbi symbol: CUTC
Origin species: Human
Product name: CUTC-cutC copper transporter homolog (E. coli) Gene
Size: 2ug
Accessions: BC015059
Gene id: 51076
Gene description: cutC copper transporter homolog (E. coli)
Synonyms: cutC copper transporter; cutC copper transporter homolog; copper homeostasis protein cutC homolog; CGI-32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaaggcagggggcctcctctgagcgaaaacgagcgcggataccgtccgggaaggccggagcagcaaatggatttctcatggaagtttgtgttgattcagtggaatcagctgtgaatgcagaaagaggaggtgctgatcggattgaattatgttctggtttatcagaggggggaactacacccagcatgggtgtccttcaagtagtgaagcagagtgttcagatcccagtttttgtgatgattcggccacggggaggtgattttttgtattcagatcgtgaaattgaggtgatgaaggctgacattcgtcttgccaagctttatggtgctgatggtttggtttttggggcattgactgaagatggacacattgacaaagagctgtgtatgtcccttatggctatttgccgccctctgccagtcactttccaccgagcctttgacatggttcatgatccaatggcagtctggagaccctcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane 4 L six family member 18
- C-type lectin domain family 3, member B
- RAB7, member RAS oncogene family-like 1
- chromosome 14 open reading frame 179

Buy CUTC-cutC copper transporter homolog (E. coli) Gene now

Add to cart