Login to display prices
Login to display prices
C14orf179-chromosome 14 open reading frame 179 Gene View larger

C14orf179-chromosome 14 open reading frame 179 Gene

PTXBC010436

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf179-chromosome 14 open reading frame 179 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf179-chromosome 14 open reading frame 179 Gene

Proteogenix catalog: PTXBC010436
Ncbi symbol: C14orf179
Product name: C14orf179-chromosome 14 open reading frame 179 Gene
Size: 2ug
Accessions: BC010436
Gene id: 112752
Gene description: chromosome 14 open reading frame 179
Synonyms: C14orf179; CED3; intraflagellar transport protein 43 homolog; IFT complex A subunit; intraflagellar transport 43 homolog; intraflagellar transport 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggatttgctcgacttggacgaggagcttcgctacagcttggctacctccagggccaagatgggtcgccgagctcaacaggagtcagcgcaggccgagaatcacctcaatggcaagaattcctctttgactctgactggagagacttcctctgctaaattacctcgctgccgacagggaggctgggcaggtgattccgtgaaggcttcgaacggtacccaaacaggcaaacaacagctggatctgaacgcatgctatcacaaaacgcatcacagaaatttggggctggcttcattggaagaggcagatattcctatcattccggatctggaggaagtacaggaagaagactttgttttgcaggtggcagcccctcccagcatccagataaagcgggtgatgacctaccgtgacctggacaatgacctcatgaagtactcagccattcagacactggatggggagatcgacctgaaactcctcaccaaagtgctcgcgccggagcacgaagtccgggaggatgatgtcggctgggactgggaccatctgttcactgaggtgtcctcagaggtcctcactgagtgggacccactgcagacggagaaggaggaccctgcggggcaggccaggcacacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: