IDI1-isopentenyl-diphosphate delta isomerase 1 Gene View larger

IDI1-isopentenyl-diphosphate delta isomerase 1 Gene

PTXBC006999

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IDI1-isopentenyl-diphosphate delta isomerase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IDI1-isopentenyl-diphosphate delta isomerase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006999
Product type: DNA & cDNA
Ncbi symbol: IDI1
Origin species: Human
Product name: IDI1-isopentenyl-diphosphate delta isomerase 1 Gene
Size: 2ug
Accessions: BC006999
Gene id: 3422
Gene description: isopentenyl-diphosphate delta isomerase 1
Synonyms: IPP1; IPPI1; isopentenyl-diphosphate Delta-isomerase 1; IPP isomerase 1; isopentenyl diphosphate dimethylallyl diphosphate isomerase 1; isopentenyl pyrophosphate isomerase 1; isopentenyl-diphosphate delta isomerase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgcctgaaataaacactaaccacctcgacaagcaacaggttcaactcctggcagagatgtgtatccttattgatgaaaatgacaataaaattggagctgagaccaagaagaattgtcacctgaacgagaacattgagaaaggattattgcatcgagcttttagtgtcttcttattcaacaccgaaaataagcttctgctacagcaaagatcagatgctaagattacctttccaggttgttttacgaatacgtgttgtagtcatccattaagcaatccagccgagcttgaggaaagtgacgcccttggagtgaggcgagcagcacagagacggctgaaagctgagctaggaattcccttggaagaggttcctccagaagaaattaattatttaacacgaattcactacaaagctcagtctgatggtatctggggtgaacatgaaattgattacattttgttggtgaggaagaatgtaactttgaatccagatcccaatgagattaaaagctattgtcatgtgtcaaaggaagaactaaaagaacttctgaaaaaagcagccagtggtgaaattaagataacgccatggtttaaaattattgcagcgacttttctctttaaatggtgggataacttaaatcatttgaatcagtttgttgaccatgagaaaatatacagaatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, FYVE domain containing 21
- chromosome 14 open reading frame 166
- coatomer protein complex, subunit epsilon
- polymerase (RNA) I polypeptide E, 53kDa

Buy IDI1-isopentenyl-diphosphate delta isomerase 1 Gene now

Add to cart