Login to display prices
Login to display prices
POLR1E-polymerase (RNA) I polypeptide E, 53kDa Gene View larger

POLR1E-polymerase (RNA) I polypeptide E, 53kDa Gene

PTXBC014331

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR1E-polymerase (RNA) I polypeptide E, 53kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR1E-polymerase (RNA) I polypeptide E, 53kDa Gene

Proteogenix catalog: PTXBC014331
Ncbi symbol: POLR1E
Product name: POLR1E-polymerase (RNA) I polypeptide E, 53kDa Gene
Size: 2ug
Accessions: BC014331
Gene id: 64425
Gene description: polymerase (RNA) I polypeptide E, 53kDa
Synonyms: PAF53; PRAF1; DNA-directed RNA polymerase I subunit RPA49; DNA-directed RNA polymerase I subunit E; RNA polymerase I subunit A49; RNA polymerase I-associated factor 53; polymerase (RNA) I associated factor 1; polymerase (RNA) I polypeptide E; polymerase (RNA) I polypeptide E, 53kDa; polymerase (RNA) I subunit E; RNA polymerase I subunit E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggaggtgttgccgagtgcgaggtggcagtattgtggggcgcccgacgggagccagagagctgtactggtccagttctccaacgggaagctacagagtccaggcaacatgcgctttaccttgtatgagaacaaagattccaccaaccccaggaagaggaatcaacggatcctggcagctgaaacagataggctctcctatgtgggaaacaattttgggactggagccctcaaatgcaacactttgtgcaggcactttgtgggaattttgaacaagacctctggccaaatggaagtatatgatgctgaattgttcaacatgcagccactattttcagatgtatcagttgagagtgaactggctctagagagtcagaccaaaacttacagagaaaagatggattcttgtattgaagcctttggtaccactaaacagaagcgagctctgaacaccaggagaatgaacagagttggcaatgaatctttgaatcgtgcagtggctaaagctgcagagactatcattgatacgaagggtgtgactgctctggtcagcgatgctatccacaatgacttgcaagatgactccctctaccttcctccctgctatgatgatgcagccaagcctgaagacgtgtataaatttgaagatcttctttcccctgcggagtatgaagctcttcagagcccatctgaagctttcaggaacgtcacgtcagaagaaatactgaagatgattgaggagaacagccattgcacctttgtcatagaagcgttgaagtctttgccatcagatgtggagagccgagaccgccaggcccgatgcatatggtttctggataccctcatcaaatttcgagctcatagggtagttaagcggaaaagtgctctgggacctggagttccccacatcatcaacaccaaactgctgaagcactttacctgcttgacctacaacaatggcagattacggaacttaatttcggattctatgaaggcgaagattactgcatatgtgatcatacttgccttgcacatacatgacttccaaattgacctgacagtgttacagagggacttgaagctcagtgagaaaaggatgatggagatagccaaagccatgaggctgaagatctccaaaagaaaggtgtctgtggccgccggcagtgaagaagatcacaaactgggcaccctgtccctcccgctgcctccagcccagacctcagaccgcctggcaaagcggaggaagattacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: