Login to display prices
Login to display prices
POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene View larger

POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene

PTXBC015319

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene

Proteogenix catalog: PTXBC015319
Ncbi symbol: POLR1D
Product name: POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene
Size: 2ug
Accessions: BC015319
Gene id: 51082
Gene description: polymerase (RNA) I polypeptide D, 16kDa
Synonyms: AC19; POLR1C; RPA16; RPA9; RPAC2; RPC16; RPO1-3; TCS2; DNA-directed RNA polymerases I and III subunit RPAC2; DNA-directed RNA polymerase I subunit D; RNA polymerases I and III subunit AC2; polymerase (RNA) I polypeptide D; polymerase (RNA) I polypeptide D, 16kDa; polymerase (RNA) I subunit D; RNA polymerase I subunit D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaggatcaggagctggagaggaaagcaatagaagaactgcttaaggaggcaaaacgtgggaaaactagagctgaaacaatgggacccatgggttggatgaagtgtcctcttgctagcaccaataaaagatttctaattaacacaattaaaaacacattgccctctcataaagagcaagaccatgaacaaaaagagggcgataaggaaccagcgaagagccaggcccagaaagaagaaaacccgaagaaacacagaagccatccttacaagcacagcttccgcgctcgaggttccgccagttactccccgccacgaaagcggagcagccaggacaagtacgaaaagcggtccaaccggcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: