MCFD2-multiple coagulation factor deficiency 2 Gene View larger

MCFD2-multiple coagulation factor deficiency 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCFD2-multiple coagulation factor deficiency 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MCFD2-multiple coagulation factor deficiency 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040357
Product type: DNA & cDNA
Ncbi symbol: MCFD2
Origin species: Human
Product name: MCFD2-multiple coagulation factor deficiency 2 Gene
Size: 2ug
Accessions: BC040357
Gene id: 90411
Gene description: multiple coagulation factor deficiency 2
Synonyms: F5F8D; F5F8D2; LMAN1IP; SDNSF; multiple coagulation factor deficiency protein 2; neural stem cell-derived neuronal survival protein; multiple coagulation factor deficiency 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccatgagatccctgctcagaacccccttcctgtgtggcctgctctgggccttttgtgccccaggcgccagggctgaggagcctgcagccagcttctcccaacccggcagcatgggcctggataagaacacagtgcacgaccaagagcatatcatggagcatctagaaggtgtcatcaacaaaccagaggcggagatgtcgccacaagaattgcagctccattacttcaaaatgcatgattatgatggcaataatttgcttgatggcttagaactctccacagccatcactcatgtccataaggaggaagggagtgaacaggcaccactaatgagtgaagatgaactgattaacataatagatggtgttttgagagatgatgacaagaacaatgatggatacattgactatgctgaatttgcaaaatcactgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 141
- hematological and neurological expressed 1
- chromosome 14 open reading frame 126
- potassium channel, subfamily K, member 4

Buy MCFD2-multiple coagulation factor deficiency 2 Gene now

Add to cart