KCNK4-potassium channel, subfamily K, member 4 Gene View larger

KCNK4-potassium channel, subfamily K, member 4 Gene

PTXBC033577

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNK4-potassium channel, subfamily K, member 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNK4-potassium channel, subfamily K, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033577
Product type: DNA & cDNA
Ncbi symbol: KCNK4
Origin species: Human
Product name: KCNK4-potassium channel, subfamily K, member 4 Gene
Size: 2ug
Accessions: BC033577
Gene id: 50801
Gene description: potassium channel, subfamily K, member 4
Synonyms: K2p4.1; TRAAK1; potassium channel subfamily K member 4; K2P4.1 potassium channel; TWIK-related arachidonic acid-stimulated potassium channel protein; potassium channel, subfamily K, member 4; potassium channel, two pore domain subfamily K, member 4; two pore K(+) channel KT4.1; two pore K+ channel KT4.1; two pore potassium channel KT4.1; potassium two pore domain channel subfamily K member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgacagctccccaggagccccccgcccggcccctccaggcgggcagtggagctggcccggcgcctgggcgcgccatgcgcagcaccacgctcctggccctgctggcgctggtcttgctttacttggtgtctggtgccctggtgttccgggccctggagcagccccacgagcagcaggcccagagggagctgggggaggtccgagagaagttcctgagggcccatccgtgtgtgagcgaccaggagctgggcctcctcatcaaggaggtggctgatgccctgggagggggtgcggacccagaaaccaactcgaccagcaacagcagccactcagcctgggacctgggcagcgccttctttttctcagggaccatcatcaccaccatcggctatggcaatgtggccctgcgcacagatgccgggcgcctcttctgcatcttttatgcgctggtggggattccgctgtttgggatcctactggcaggggtcggggaccggctgggctcctccctgcgccatggcatcggtcacattgaagccatcttcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 4, member E
- isopentenyl-diphosphate delta isomerase 1
- zinc finger, FYVE domain containing 21
- lectin, galactoside-binding, soluble, 3

Buy KCNK4-potassium channel, subfamily K, member 4 Gene now

Add to cart