CLEC4E-C-type lectin domain family 4, member E Gene View larger

CLEC4E-C-type lectin domain family 4, member E Gene

PTXBC000715

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC4E-C-type lectin domain family 4, member E Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC4E-C-type lectin domain family 4, member E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000715
Product type: DNA & cDNA
Ncbi symbol: CLEC4E
Origin species: Human
Product name: CLEC4E-C-type lectin domain family 4, member E Gene
Size: 2ug
Accessions: BC000715
Gene id: 26253
Gene description: C-type lectin domain family 4, member E
Synonyms: CLECSF9; MINCLE; C-type lectin domain family 4 member E; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9; C-type lectin superfamily member 9; macrophage-inducible C-type lectin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattcatctaaatcatctgaaacacaatgcacagagagaggatgcttctcttcccaaatgttcttatggactgttgctgggatccccatcctatttctcagtgcctgtttcatcaccagatgtgttgtgacatttcgcatctttcaaacctgtgatgagaaaaagtttcagctacctgagaatttcacagagctctcctgctacaattatggatcaggttcagtcaagaattgttgtccattgaactgggaatattttcaatccagctgctacttcttttctactgacaccatttcctgggcgttaagtttaaagaactgctcagccatgggggctcacctggtggttatcaactcacaggaggagcaggaattcctttcctacaagaaacctaaaatgagagagttttttattggactgtcagaccaggttgtcgagggtcagtggcaatgggtggacggcacacctttgacaaagtctctgagcttctgggatgtaggggagcccaacaacatagctaccctggaggactgtgccaccatgagagactcttcaaacccaaggcaaaattggaatgatgtaacctgtttcctcaattattttcggatttgtgaaatggtaggaataaatcctttgaacaaaggaaaatctctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - isopentenyl-diphosphate delta isomerase 1
- zinc finger, FYVE domain containing 21
- lectin, galactoside-binding, soluble, 3
- cutC copper transporter homolog (E. coli)

Buy CLEC4E-C-type lectin domain family 4, member E Gene now

Add to cart