CUTC-cutC copper transporter homolog (E. coli) Gene View larger

CUTC-cutC copper transporter homolog (E. coli) Gene

PTXBC021105

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CUTC-cutC copper transporter homolog (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CUTC-cutC copper transporter homolog (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021105
Product type: DNA & cDNA
Ncbi symbol: CUTC
Origin species: Human
Product name: CUTC-cutC copper transporter homolog (E. coli) Gene
Size: 2ug
Accessions: BC021105
Gene id: 51076
Gene description: cutC copper transporter homolog (E. coli)
Synonyms: cutC copper transporter; cutC copper transporter homolog; copper homeostasis protein cutC homolog; CGI-32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaaggcagggggcctcctctgagcgaaaacgagcgcggataccgtccgggaaggccggagcagcaaatggatttctcatggaagtttgtgttgattcagtggaatcagctgtgaatgcagaaagaggaggtgctgatcggattgaattatgttctggtttatcagaggggggaactacacccagcatgggtgtccttcaagtagtgaagcagagtgttcagatcccagtttttgtgatgattcggccacggggaggtgattttttgtattcagatcgtgaaattgaggtgatgaaggctgacattcgtcttgccaagctttatggtgctgatggtttggtttttggggcattgactgaagatggacacattgacaaagagctgtgtatgtcccttatggctatttgccgccctctgccagtcactttccaccgagcctttgacatggttcatgatccaatggcagctctggagaccctcttaaccttgggatttgaacgcgtgttgaccagtggatgtgacagttcagcattagaagggctacccctaataaagcgactcattgagcaggcaaaaggcaggattgtggtaatgccaggaggtggtataacagacagaaatctacaaaggatccttgagggttcaggtgctacagaattccactgttctgctcggtctactagagactcgggaatgaagtttcgaaattcatctgttgccatgggagcctcactttcttgctcagaatattccctaaaggtaacagatgtgaccaaagtaaggactttgaatgctatcgcaaagaacatcctggtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trafficking protein particle complex 1
- cytoplasmic linker associated protein 1
- chromosome 20 open reading frame 144
- enoyl Coenzyme A hydratase 1, peroxisomal

Buy CUTC-cutC copper transporter homolog (E. coli) Gene now

Add to cart