Login to display prices
Login to display prices
CUTC-cutC copper transporter homolog (E. coli) Gene View larger

CUTC-cutC copper transporter homolog (E. coli) Gene

PTXBC021105

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CUTC-cutC copper transporter homolog (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CUTC-cutC copper transporter homolog (E. coli) Gene

Proteogenix catalog: PTXBC021105
Ncbi symbol: CUTC
Product name: CUTC-cutC copper transporter homolog (E. coli) Gene
Size: 2ug
Accessions: BC021105
Gene id: 51076
Gene description: cutC copper transporter homolog (E. coli)
Synonyms: cutC copper transporter; cutC copper transporter homolog; copper homeostasis protein cutC homolog; CGI-32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaaggcagggggcctcctctgagcgaaaacgagcgcggataccgtccgggaaggccggagcagcaaatggatttctcatggaagtttgtgttgattcagtggaatcagctgtgaatgcagaaagaggaggtgctgatcggattgaattatgttctggtttatcagaggggggaactacacccagcatgggtgtccttcaagtagtgaagcagagtgttcagatcccagtttttgtgatgattcggccacggggaggtgattttttgtattcagatcgtgaaattgaggtgatgaaggctgacattcgtcttgccaagctttatggtgctgatggtttggtttttggggcattgactgaagatggacacattgacaaagagctgtgtatgtcccttatggctatttgccgccctctgccagtcactttccaccgagcctttgacatggttcatgatccaatggcagctctggagaccctcttaaccttgggatttgaacgcgtgttgaccagtggatgtgacagttcagcattagaagggctacccctaataaagcgactcattgagcaggcaaaaggcaggattgtggtaatgccaggaggtggtataacagacagaaatctacaaaggatccttgagggttcaggtgctacagaattccactgttctgctcggtctactagagactcgggaatgaagtttcgaaattcatctgttgccatgggagcctcactttcttgctcagaatattccctaaaggtaacagatgtgaccaaagtaaggactttgaatgctatcgcaaagaacatcctggtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: