C20orf144-chromosome 20 open reading frame 144 Gene View larger

C20orf144-chromosome 20 open reading frame 144 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf144-chromosome 20 open reading frame 144 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf144-chromosome 20 open reading frame 144 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032818
Product type: DNA & cDNA
Ncbi symbol: C20orf144
Origin species: Human
Product name: C20orf144-chromosome 20 open reading frame 144 Gene
Size: 2ug
Accessions: BC032818
Gene id: 128864
Gene description: chromosome 20 open reading frame 144
Synonyms: uncharacterized protein C20orf144; dJ63M2.6; bcl-2-like protein from testis; bclt; chromosome 20 open reading frame 144
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaactatagttcccacaaaaggaccaaagcacccaagcaggcccgcaaggagaggccggctgacatggacaaggcctggtggaaatcgttcctcaaccacctcactcggaagaagccggctaccaggatcgtgctgattctccccctggacaagcggcagccgctggccaacgctgggcaacggattgactacgcgtccggcgctgggctgggctccccggcggcacccagattgcgcggagcgggcgaaggtagcgagcgcgagccgaggatgccggtactgctgctgctgcggcggcaagaggcgcggcggccggaagagggcggggccagggcagctctgagctggccgcggctgctctcgcgcttccggtccccggggaaggctccccgcgaagccggccccgccgaggagcagccgcgcaaacggtgccgctgccctcgcccgcagctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - enoyl Coenzyme A hydratase 1, peroxisomal
- zinc finger, FYVE domain containing 27
- lectin, galactoside-binding, soluble, 8
- Rab9 effector protein with kelch motifs

Buy C20orf144-chromosome 20 open reading frame 144 Gene now

Add to cart