ZFYVE27-zinc finger, FYVE domain containing 27 Gene View larger

ZFYVE27-zinc finger, FYVE domain containing 27 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFYVE27-zinc finger, FYVE domain containing 27 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFYVE27-zinc finger, FYVE domain containing 27 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030621
Product type: DNA & cDNA
Ncbi symbol: ZFYVE27
Origin species: Human
Product name: ZFYVE27-zinc finger, FYVE domain containing 27 Gene
Size: 2ug
Accessions: BC030621
Gene id: 118813
Gene description: zinc finger, FYVE domain containing 27
Synonyms: PROTRUDIN; spastic paraplegia 33 protein; zinc finger FYVE domain containing 27; zinc finger FYVE-type containing 27
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctttgtgttccttgctgacctgcctgggcctcaacgtcttgttcctcactttgaatgagggtgcatggtactcagtaggtgccctgatgatttcagtgcccgccctgctgggctaccttcaggaggtttgccgggcacggctgcctgattccgagctgatgcggaggaagtatcatagcgtgaggcaggaggacctgcagagagttcgcctgtctcgtcccgaggccgtggctgaggtgaagagcttcttgatccagctggaggccttcctgagccgcctgtgctgcacatgtgaagccgcctaccgcgtgctgcactgggagaaccccgtcgtgtcctcacagttctatggggctcttctgggcacagtctgcatgctgtatttgctgccactctgctgggttctcacccttttaaacagcacgctctttctggggaatgtggagttcttccgagttgtgtctgagtacagggcatctctgcagcagaggatgaacccaaagcaggaagagcatgcctttgagagtcctccaccaccagatgttggggggaaggatggtctgatggacagcacgcctgccctcacacccacggaggacctcacaccgggcagcgtggaggaggctgaggaggctgagccagatgaagagtttaaagatgcgattgaggagacccacttggtggtgctggaggatgatgagggcgccccgtgcccagcagaggatgagctggccctgcaggacaacgggttcctgagcaagaatgaggtgctgcgcagcaaggtgtctcggctcacggagcggctccgcaagcgctaccccaccaacaacttcgggaactgcacgggctgctcggccaccttctcagtgctgaagaagaggcggagctgcagtaattgtggaaacagcttctgctctcgatgctgctccttcaaggtgcccaagtcatccatgggggccacagcccctgaagcccagagggagactgtgtttgtgtgtgcctcgtgtaaccagaccttgagcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lectin, galactoside-binding, soluble, 8
- Rab9 effector protein with kelch motifs
- mitochondrial trans-2-enoyl-CoA reductase
- serum response factor binding protein 1

Buy ZFYVE27-zinc finger, FYVE domain containing 27 Gene now

Add to cart