LGALS8-lectin, galactoside-binding, soluble, 8 Gene View larger

LGALS8-lectin, galactoside-binding, soluble, 8 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LGALS8-lectin, galactoside-binding, soluble, 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LGALS8-lectin, galactoside-binding, soluble, 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015818
Product type: DNA & cDNA
Ncbi symbol: LGALS8
Origin species: Human
Product name: LGALS8-lectin, galactoside-binding, soluble, 8 Gene
Size: 2ug
Accessions: BC015818
Gene id: 3964
Gene description: lectin, galactoside-binding, soluble, 8
Synonyms: Gal-8; PCTA-1; PCTA1; Po66-CBP; galectin-8; Po66 carbohydrate binding protein; galectin-8g; lectin, galactoside-binding, soluble, 8; po66 carbohydrate-binding protein; prostate carcinoma tumor antigen 1; galectin 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgtccttaaacaacctacagaatatcatctataacccggtaatcccgtatgttggcaccattcccgatcagctggatcctggaactttgattgtgatatgtgggcatgttcctagtgacgcagacagattccaggtggatctgcagaatggcagcagtgtgaaacctcgagccgatgtggcctttcatttcaatcctcgtttcaaaagggccggctgcattgtttgcaatactttgataaatgaaaaatggggacgggaagagatcacctatgacacgcctttcaaaagagaaaagtcttttgagatcgtgattatggtgctaaaggacaaattccaggtggctgtaaatggaaaacatactctgctctatggccacaggatcggcccagagaaaatagacactctgggcatttatggcaaagtgaatattcactcaattggttttagcttcagctcggacttacaaagtacccaagcatctagtctggaactgacagagataagtagagaaaatgttccaaagtctggcacgccccagcttcctagtaatagaggaggagacatttctaaaatcgcacccagaactgtctacaccaagagcaaagattcgactgtcaatcacactttgacttgcaccaaaataccacctatgaactatgtgtcaaagagcctgccattcgctgcaaggttgaacacccccatgggccctggacgaactgtcgtcgttaaaggagaagtgaatgcaaatgccaaaagctttaatgttgacctactagcaggaaaatcaaaggatattgctctacacttgaacccacgcctgaatattaaagcatttgtaagaaattcttttcttcaggagtcctggggagaagaagagagaaatattacctctttcccatttagtcctgggatgtactttgagatgataatttactgtgatgttagagaattcaaggttgcagtaaatggcgtacacagcctggagtacaaacacagatttaaagagctcagcagtattgacacgctggaaattaatggagacatccacttactggaagtaaggagctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rab9 effector protein with kelch motifs
- mitochondrial trans-2-enoyl-CoA reductase
- serum response factor binding protein 1
- cytoplasmic linker associated protein 2

Buy LGALS8-lectin, galactoside-binding, soluble, 8 Gene now

Add to cart