CLASP2-cytoplasmic linker associated protein 2 Gene View larger

CLASP2-cytoplasmic linker associated protein 2 Gene

PTXBC029035

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLASP2-cytoplasmic linker associated protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLASP2-cytoplasmic linker associated protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029035
Product type: DNA & cDNA
Ncbi symbol: CLASP2
Origin species: Human
Product name: CLASP2-cytoplasmic linker associated protein 2 Gene
Size: 2ug
Accessions: BC029035
Gene id: 23122
Gene description: cytoplasmic linker associated protein 2
Synonyms: CLIP-associating protein CLASP2; CLIP-associating protein 2; multiple asters (Mast)-like homolog 2; protein Orbit homolog 2; cytoplasmic linker associated protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcgactgatttgcaaacggatctgtgattataaaagcttcgatgatgaagaatcagtggatggaaataggccatcatcagctgcatcagccttcaaggttcctgcacctaaaacatccggaaatcctgccaacagtgcaaggaagcctggttcagcaggtggccctaaggttggaggtgcttctaaggaaggaggtgctggagcagttgatgaagatgattttataaaagcttttacagatgtcccttctattcagatttattctagtcgagaactcgaagaaacattaaataaaatcagggaaattttgtcagatgataaacatgactgggatcagcgtgccaatgcactgaagaaaattcgatcactgcttgttgctggagctgcacagtatgattgcttttttcaacatttacgattgttggatggagcacttaaactttcagctaaggatcttagatcccaggtggttagagaagcttgtattactgtagcccacctttcaacagttttgggaaacaagtttgatcatggcgctgaagccattgtacctacactttttaatctcgtccccaatagtgcaaaagtcatggcaacttctggatgtgcagcaatcagatttatcattcggcatactcatgtacccagacttatacctttaataacaagcaattgcacatcaaaatcagttcccgtgaggagacgttcatttgaatttttagatttattgttgcaagagtggcagactcattcattggaaagacatgcagccgtcttggttgaaactattaaaaagggaattcatgatgctgacgctgaggccagagtggaggcaagaaagacatacatgggtcttagaaaccactttcctggtgaagctgaaacattatataattcccttgagccatcttatcagaagagtcttcaaacttacttaaagagttctggcagtgtagcatctcttccacaatcagacaggtcctcatccagctcacaggaaagtctcaatcgccctttttcttccaaatggtctacagcaaatccatcaactgtggctggaagagtatcagcaggcagcagcaaagccagttcccttccaggaagcctgcagcgttcacgaagtgacattgatgtgaatgctgctgcaggtgccaaggcacatcatgctgctggacagtctgtgcgaagcgggcgcttaggtgcaggtgccctgaatgcaggttcctatgcgtcactagaatgtgaagccttttggagatctgggagaactgcaaagctctactctgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prolylcarboxypeptidase (angiotensinase C)
- S-adenosylhomocysteine hydrolase-like 1
- homeodomain interacting protein kinase 4
- acetylserotonin O-methyltransferase-like

Buy CLASP2-cytoplasmic linker associated protein 2 Gene now

Add to cart