RABEPK-Rab9 effector protein with kelch motifs Gene View larger

RABEPK-Rab9 effector protein with kelch motifs Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RABEPK-Rab9 effector protein with kelch motifs Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RABEPK-Rab9 effector protein with kelch motifs Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000503
Product type: DNA & cDNA
Ncbi symbol: RABEPK
Origin species: Human
Product name: RABEPK-Rab9 effector protein with kelch motifs Gene
Size: 2ug
Accessions: BC000503
Gene id: 10244
Gene description: Rab9 effector protein with kelch motifs
Synonyms: RAB9P40; bA65N13.1; p40; rab9 effector protein with kelch motifs; 40 kDa Rab9 effector protein; Rab9 effector p40
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcaactgccagtcttggaacctggagacaagcccaggaaagcaacatggtacaccttgactgtccctggagacagcccctgtgctcgagttggccacagctgttcatatttacccccagttggtaatgccaagagagggaaggtcttcattgttgggggagcaaatccaaacagaagcttctcagacgtgcacaccatggatctgggaaaataccagtgggacttagatacctgcaagggcctcttgccccggtatgaacatgctagcttcattccctcctgcacacctgaccgtatctgggtatttggaggtgccaaccaatcaggaaatcgaaattgtctacaagtcctgaatcctgaaaccaggacgtggaccacgccagaagtgaccagccccccaccatccccaagaacattccacacatcatcggcagccattggaaaccagctatatgtctttgggggcggagagagaggtgcccagcccgtgcaggacacgaagctgcatgtgtttgacgcaaacactctgacctggtcacagccagagacacttggaaatcctccatctccccggcatggtcatgtgatggtggcagcagggacaaagctcttcatccacggaggcttggcgggggacagattctatgatgacctccactgcattgatataagtgacatgaaatggcagaagctaaatcccactggggctgctccagcaggctgtgctgcccactcagctgtggccatgggaaaacatgtgtacatctttggtggaatgactcctgcaggagcactggacacaatgtaccagtatcacacagaagagcagcattggaccttgcttaaatttgatactcttctaccccctggacgattggaccattccatgtgtatcattccatggccagtgacgtgtgcttctgagaaagaaggttccaactctctcactctgaaccatgaagctgagaaagaggattcagctgacaaagtaatgagccacagtggtgactcacatgaggaaagccagactgctacactgctctgtttggtgtttggtgggatgaatacagaaggggaaatctatgacgattgtattgtgactgtagtggactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial trans-2-enoyl-CoA reductase
- serum response factor binding protein 1
- cytoplasmic linker associated protein 2
- prolylcarboxypeptidase (angiotensinase C)

Buy RABEPK-Rab9 effector protein with kelch motifs Gene now

Add to cart