MECR-mitochondrial trans-2-enoyl-CoA reductase Gene View larger

MECR-mitochondrial trans-2-enoyl-CoA reductase Gene

PTXBC001419

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MECR-mitochondrial trans-2-enoyl-CoA reductase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MECR-mitochondrial trans-2-enoyl-CoA reductase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001419
Product type: DNA & cDNA
Ncbi symbol: MECR
Origin species: Human
Product name: MECR-mitochondrial trans-2-enoyl-CoA reductase Gene
Size: 2ug
Accessions: BC001419
Gene id: 51102
Gene description: mitochondrial trans-2-enoyl-CoA reductase
Synonyms: CGI-63; FASN2B; NRBF1; trans-2-enoyl-CoA reductase, mitochondrial; homolog of yeast 2-enoyl thioester reductase; mitochondrial 2-enoyl thioester reductase; nuclear receptor binding factor 1; mitochondrial trans-2-enoyl-CoA reductase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggtctgcagtaccctgtggcgggtgcgaacccccgcccggcagtggcgggggctgctcccagcttctggctgtcacggacctgccgcctcctcctactccgcatccgccgagcctgcccgggtccgggcgcttgtctatgggcaccacggggatccagccaaggtcgtcgaactcaagaacctggagctagctgctgtgagaggatcagatgtccgtgtgaagatgctggcggcccctatcaatccatctgacataaatatgatccaaggaaactacggactccttcctgaactgcctgctgttggagggaacgaaggtgttgcacaggtggtagcggtgggcagcaatgtgaccgggctgaagccaggagactgggtgattccagcaaatgctggtttaggaacctggcggaccgaggctgtgttcagcgaggaagcactgatccaagttccgagtgacatccctcttcagagcgctgccaccctgggtgtcaatccctgcacagcctacaggatgttgatggacttcgagcaactgcagccaggggattctgtcatccagaatgcatccaacagcggagtggggcaagcggtcatccagatcgccgcagccctgggcctaagaaccatcaatgtggtccgagacagacctgatatccagaagctgagtgacagactgaagagtctgggggctgagcatgtcatcacagaagaggagctaagaaggcccgaaatgaaaaacttctttaaggacatgccccagccacggcttgctctcaactgtgttggtgggaaaagctccacagagctgctgcggcagttagcgcgtggaggaaccatggtaacctatggggggatggccaagcagcccgtcgtagcctctgtgagcctgctcatttttaaggatctcaaacttcgaggcttttggttgtcccagtggaagaaggatcacagtccagaccagttcaaggagctgatcctcacactgtgcgatctcatccgccgaggccagctcacagcccctgcctgctcccaggtcccgctgcaggactaccagtctgccttggaagcctccatgaagcccttcatatcttcaaagcagattctcaccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serum response factor binding protein 1
- cytoplasmic linker associated protein 2
- prolylcarboxypeptidase (angiotensinase C)
- S-adenosylhomocysteine hydrolase-like 1

Buy MECR-mitochondrial trans-2-enoyl-CoA reductase Gene now

Add to cart