Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TRAPPC1-trafficking protein particle complex 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRAPPC1-trafficking protein particle complex 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032717 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRAPPC1 |
| Origin species: | Human |
| Product name: | TRAPPC1-trafficking protein particle complex 1 Gene |
| Size: | 2ug |
| Accessions: | BC032717 |
| Gene id: | 58485 |
| Gene description: | trafficking protein particle complex 1 |
| Synonyms: | BET5; MUM2; trafficking protein particle complex subunit 1; BET5 homolog; MUM-2; melanoma ubiquitous mutated 2; multiple myeloma protein 2; trafficking protein particle complex 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgtccacaacctgtacctgtttgaccggaatggagtgtgtctgcactacagcgaatggcaccgcaagaagcaagcagggattcccaaggaggaggagtataagctgatgtacgggatgctcttctctatccgctcgtttgtcagcaagatgtccccgctagacatgaaggatggcttcctggccttccaaactagccgttacaaactccattactacgagacgcccactgggatcaaagttgtcatgaatactgacttgggcgtgggacccatccgagatgtgctgcaccacatctacagtgcgctgtatgtggagctggtggtgaagaatcccctgtgcccgctgggccaaactgtgcaaagtgagctctttcgctcccgactggactcctatgttcgctctctgcccttcttctccgcccgggctggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytoplasmic linker associated protein 1 - chromosome 20 open reading frame 144 - enoyl Coenzyme A hydratase 1, peroxisomal - zinc finger, FYVE domain containing 27 |