TRAPPC1-trafficking protein particle complex 1 Gene View larger

TRAPPC1-trafficking protein particle complex 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRAPPC1-trafficking protein particle complex 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRAPPC1-trafficking protein particle complex 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032717
Product type: DNA & cDNA
Ncbi symbol: TRAPPC1
Origin species: Human
Product name: TRAPPC1-trafficking protein particle complex 1 Gene
Size: 2ug
Accessions: BC032717
Gene id: 58485
Gene description: trafficking protein particle complex 1
Synonyms: BET5; MUM2; trafficking protein particle complex subunit 1; BET5 homolog; MUM-2; melanoma ubiquitous mutated 2; multiple myeloma protein 2; trafficking protein particle complex 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgtccacaacctgtacctgtttgaccggaatggagtgtgtctgcactacagcgaatggcaccgcaagaagcaagcagggattcccaaggaggaggagtataagctgatgtacgggatgctcttctctatccgctcgtttgtcagcaagatgtccccgctagacatgaaggatggcttcctggccttccaaactagccgttacaaactccattactacgagacgcccactgggatcaaagttgtcatgaatactgacttgggcgtgggacccatccgagatgtgctgcaccacatctacagtgcgctgtatgtggagctggtggtgaagaatcccctgtgcccgctgggccaaactgtgcaaagtgagctctttcgctcccgactggactcctatgttcgctctctgcccttcttctccgcccgggctggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytoplasmic linker associated protein 1
- chromosome 20 open reading frame 144
- enoyl Coenzyme A hydratase 1, peroxisomal
- zinc finger, FYVE domain containing 27

Buy TRAPPC1-trafficking protein particle complex 1 Gene now

Add to cart