Login to display prices
Login to display prices
CLASP1-cytoplasmic linker associated protein 1 Gene View larger

CLASP1-cytoplasmic linker associated protein 1 Gene

PTXBC032563

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLASP1-cytoplasmic linker associated protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLASP1-cytoplasmic linker associated protein 1 Gene

Proteogenix catalog: PTXBC032563
Ncbi symbol: CLASP1
Product name: CLASP1-cytoplasmic linker associated protein 1 Gene
Size: 2ug
Accessions: BC032563
Gene id: 23332
Gene description: cytoplasmic linker associated protein 1
Synonyms: MAST1; CLIP-associating protein 1; multiple asters 1; multiple asters homolog 1; protein Orbit homolog 1; cytoplasmic linker associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagactctggaagcccacaaagactcccataaggaggtggtgagagcggctgaggaggctgcgtccacactggccagttccatccacccggagcagtgcatcaaggtgctctgccccatcatccagacggccgactaccccatcaaccttgctgccatcaagatgcagaccaaagtcgtcgagaggatcgcaaaggagtcattgctgcagctccttgtcgacatcatcccaggcttgctgcagggttatgacaacaccgaaagtagtgtgcgtaaggccagcgtgttttgcttagtggcaatttattccgtaatcggagaagacctgaaacctcaccttgcacagctcacagggagcaagatgaagctactaaacttatacataaagagggcccagaccaccaacagcaacagcagctcctcctccgatgtctccacgcacagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: