LGALS3-lectin, galactoside-binding, soluble, 3 Gene View larger

LGALS3-lectin, galactoside-binding, soluble, 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LGALS3-lectin, galactoside-binding, soluble, 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LGALS3-lectin, galactoside-binding, soluble, 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001120
Product type: DNA & cDNA
Ncbi symbol: LGALS3
Origin species: Human
Product name: LGALS3-lectin, galactoside-binding, soluble, 3 Gene
Size: 2ug
Accessions: BC001120
Gene id: 3958
Gene description: lectin, galactoside-binding, soluble, 3
Synonyms: CBP35; GAL3; GALBP; GALIG; L31; LGALS2; MAC2; galectin-3; 35 kDa lectin; IgE-binding protein; MAC-2 antigen; advanced glycation end-product receptor 3; carbohydrate-binding protein 35; galactose-specific lectin 3; laminin-binding protein; lectin L-29; lectin, galactoside-binding, soluble, 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagacaatttttcgctccatgatgcgttatctgggtctggaaacccaaaccctcaaggatggcctggcgcatgggggaaccagcctgctggggcagggggctacccaggggcttcctatcctggggcctaccccgggcaggcacccccaggggcttatcctggacaggcacctccaggcgcctaccctggagcacctggagcttatcccggagcacctgcacctggagtctacccagggccacccagcggccctggggcctacccatcttctggacagccaagtgccaccggagcctaccctgccactggcccctatggcgcccctgctgggccactgattgtgccttataacctgcctttgcctgggggagtggtgcctcgcatgctgataacaattctgggcacggtgaagcccaatgcaaacagaattgctttagatttccaaagagggaatgatgttgccttccactttaacccacgcttcaatgagaacaacaggagagtcattgtttgcaatacaaagctggataataactggggaagggaagaaagacagtcggttttcccatttgaaagtgggaaaccattcaaaatacaagtactggttgaacctgaccacttcaaggttgcagtgaatgatgctcacttgttgcagtacaatcatcgggttaaaaaactcaatgaaatcagcaaactgggaatttctggtgacatagacctcaccagtgcttcatataccatgatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cutC copper transporter homolog (E. coli)
- trafficking protein particle complex 1
- cytoplasmic linker associated protein 1
- chromosome 20 open reading frame 144

Buy LGALS3-lectin, galactoside-binding, soluble, 3 Gene now

Add to cart