C14orf126-chromosome 14 open reading frame 126 Gene View larger

C14orf126-chromosome 14 open reading frame 126 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf126-chromosome 14 open reading frame 126 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf126-chromosome 14 open reading frame 126 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010618
Product type: DNA & cDNA
Ncbi symbol: C14orf126
Origin species: Human
Product name: C14orf126-chromosome 14 open reading frame 126 Gene
Size: 2ug
Accessions: BC010618
Gene id: 112487
Gene description: chromosome 14 open reading frame 126
Synonyms: C14orf126; D-tyrosyl-tRNA deacylase 2 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagggtagccggattcctcaggcccgggcgctcctacagcagtgcctgcacgcccggctgcaaattcgcccagccgatggggacgtcgcggcccagtgggtggaggtccaaagaggactggtgatctacgtgtgctttttcaagggagctgataaagaacttcttcccaaaatggttaatacactgttaaatgtgaaattaagtgagacagaaaatggcaagcatgtctctatattggatctacctggcaacattcttattatccctcaagctacccttggaggaagactaaaaggaagaaacatgcaatatcactctaactctggaaaagaagaagggtttgaactttactctcaatttgtgactctatgtgaaaaagaagtagctgctaatagcaagtgtgctgaagctagggttgtagtggaacatggcacttatgggaacaggcaggtgttaaagctggacaccaacggaccattcacacacttaattgagttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium channel, subfamily K, member 4
- C-type lectin domain family 4, member E
- isopentenyl-diphosphate delta isomerase 1
- zinc finger, FYVE domain containing 21

Buy C14orf126-chromosome 14 open reading frame 126 Gene now

Add to cart