HN1-hematological and neurological expressed 1 Gene View larger

HN1-hematological and neurological expressed 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HN1-hematological and neurological expressed 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HN1-hematological and neurological expressed 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001420
Product type: DNA & cDNA
Ncbi symbol: HN1
Origin species: Human
Product name: HN1-hematological and neurological expressed 1 Gene
Size: 2ug
Accessions: BC001420
Gene id: 51155
Gene description: hematological and neurological expressed 1
Synonyms: ARM2; HN1A; hematological and neurological expressed 1 protein; androgen-regulated protein 2; hematological and neurological expressed 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacaaccaccaccttcaagggagtcgaccccaacagcaggaatagctcccgagttttgcggcctccaggtggtggatccaatttttcattaggttttgatgaaccaacagaacaacctgtgaggaagaacaaaatggcctctaatatctttgggacacctgaagaaaatcaagcttcttgggccaagtcagcaggtgccaagtctagtggtggcagggaagacttggagtcatctggactgcagagaaggaactcctctgaagcaagctccggagacttcttagatctgaagggagaaggtgatattcatgaaaatgtggacacagacttgccaggcagcctggggcagagtgaagagaagcccgtgcctgctgcgcctgtgcccagcccggtggccccggccccagtgccatccagaagaaatccccctggcggcaagtccagcctcgtcttgggttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 126
- potassium channel, subfamily K, member 4
- C-type lectin domain family 4, member E
- isopentenyl-diphosphate delta isomerase 1

Buy HN1-hematological and neurological expressed 1 Gene now

Add to cart