Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LGALS1-lectin, galactoside-binding, soluble, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LGALS1-lectin, galactoside-binding, soluble, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001693 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LGALS1 |
| Origin species: | Human |
| Product name: | LGALS1-lectin, galactoside-binding, soluble, 1 Gene |
| Size: | 2ug |
| Accessions: | BC001693 |
| Gene id: | 3956 |
| Gene description: | lectin, galactoside-binding, soluble, 1 |
| Synonyms: | GAL1; GBP; galectin-1; 14 kDa laminin-binding protein; 14 kDa lectin; HBL; HLBP14; HPL; S-Lac lectin 1; beta-galactoside-binding lectin L-14-I; beta-galactoside-binding protein 14kDa; gal-1; galaptin; lactose-binding lectin 1; lectin, galactoside-binding, soluble, 1; galectin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttgtggtctggtcgccagcaacctgaatctcaaacctggagagtgccttcgagtgcgaggcgaggtggctcctgacgctaagagcttcgtgctgaacctgggcaaagacagcaacaacctgtgcctgcacttcaaccctcgcttcaacgcccacggcgacgccaacaccatcgtgtgcaacagcaaggacggcggggcctgggggaccgagcagcgggaggctgtctttcccttccagcctggaagtgttgcagaggtgtgcatcaccttcgaccaggccaacctgaccgtcaagctgccagatggatacgaattcaagttccccaaccgcctcaacctggaggccatcaactacatggcagctgacggtgacttcaagatcaaatgtgtggcctttgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 14 open reading frame 129 - multiple coagulation factor deficiency 2 - chromosome 20 open reading frame 141 - hematological and neurological expressed 1 |