Login to display prices
Login to display prices
C14orf129-chromosome 14 open reading frame 129 Gene View larger

C14orf129-chromosome 14 open reading frame 129 Gene

PTXBC004818

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf129-chromosome 14 open reading frame 129 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf129-chromosome 14 open reading frame 129 Gene

Proteogenix catalog: PTXBC004818
Ncbi symbol: C14orf129
Product name: C14orf129-chromosome 14 open reading frame 129 Gene
Size: 2ug
Accessions: BC004818
Gene id: 51527
Gene description: chromosome 14 open reading frame 129
Synonyms: C14orf129; HSPC210; GSK3-beta interaction protein; GSK3B interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaacagactgtaatcccatggagctaagcagtatgtcaggatttgaagaaggttcagagctgaacggttttgaaggaactgacatgaaagacatgaggctcgaagctgaagcagttgtaaatgatgttctctttgctgttaacaacatgtttgtctcgaaaagcctgcggtgtgcggatgatgtggcctatatcaatgtggaaacaaaggaaagaaacagatattgcctagaactcactgaagcagggctcaaggtggtaggctatgcttttgaccaggtagatgatcatttacagactccctaccatgaaacagtctactccttgttggatacactcagccccgcctaccgagaagcatttggaaacgcactgcttcaaagactggaagctttgaaaagagatggacagtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: