C14orf166-chromosome 14 open reading frame 166 Gene View larger

C14orf166-chromosome 14 open reading frame 166 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf166-chromosome 14 open reading frame 166 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf166-chromosome 14 open reading frame 166 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001722
Product type: DNA & cDNA
Ncbi symbol: C14orf166
Origin species: Human
Product name: C14orf166-chromosome 14 open reading frame 166 Gene
Size: 2ug
Accessions: BC001722
Gene id: 51637
Gene description: chromosome 14 open reading frame 166
Synonyms: UPF0568 protein C14orf166; CGI-99; CGI99; CLE; CLE7; LCRP369; RLLM1; hCLE1; CLE7 homolog; RLL motif containing 1; chromosome 14 open reading frame 166
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccgacgcaagttgacggctctcgactaccacaaccccgccggcttcaactgcaaagatgaaacagaatttagaaacttcatcgtttggcttgaagaccagaaaatcaggcactacaagattgaagacagagggaatttaagaaacatccacagcagcgactggcccaagttctttgaaaagtatctcagagatgttaactgtcctttcaagattcaagatcgacaagaagctattgactggcttcttggtttagctgttagacttgaatatggagataatgctgaaaaatacaaggatttagtacctgataattcaaaaactgctgacaatgcaactaaaaatgcagaaccattgatcaatttggatgtaaataatcctgattttaaggctggtgtgatggctttggctaacctgcttcagattcagcgtcatgatgattacctggtaatgcttaaggcaattcggattttggttcaggagcgcctgacacaggatgcagttgctaaggcaaatcaaacaaaagagggcttacctgttgctttagacaaacatattcttggttttgacacaggagatgcagttcttaatgaagctgctcaaattctgcgattgctgcacatagaggagctcagagagctacagacaaaaatcaacgaagccatagtagctgttcaggcaattattgctgatccaaagacagaccacagactgggaaaagttggaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coatomer protein complex, subunit epsilon
- polymerase (RNA) I polypeptide E, 53kDa
- coatomer protein complex, subunit beta 1
- polymerase (RNA) I polypeptide D, 16kDa

Buy C14orf166-chromosome 14 open reading frame 166 Gene now

Add to cart