ZFYVE21-zinc finger, FYVE domain containing 21 Gene View larger

ZFYVE21-zinc finger, FYVE domain containing 21 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFYVE21-zinc finger, FYVE domain containing 21 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFYVE21-zinc finger, FYVE domain containing 21 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005999
Product type: DNA & cDNA
Ncbi symbol: ZFYVE21
Origin species: Human
Product name: ZFYVE21-zinc finger, FYVE domain containing 21 Gene
Size: 2ug
Accessions: BC005999
Gene id: 79038
Gene description: zinc finger, FYVE domain containing 21
Synonyms: HCVP7TP1; ZF21; zinc finger FYVE domain-containing protein 21; FYVE domain containing 21; HCV p7-transactivated protein 1; zinc finger, FYVE domain containing 21; zinc finger FYVE-type containing 21
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctccgaggtgtccgcgcgccgcgacgccaagaagctggtgcgctccccgagcggcctgcgcatggtgcccgaacaccgcgccttcggaagcccgttcggcctggaggagccgcagtgggtcccggacaaggagtgtcggagatgtatgcagtgtgacgccaagtttgactttctcaccagaaagcaccactgtcgccgctgcgggaagtgcttctgcgacaggtgctgcagccagaaggtgccgctgcggcgcatgtgctttgtggaccccgtgcggcagtgcgcggagtgcgccctcgtgtccctcaaggaggcggagttctacgacaagcagctcaaagtgctcctgagcggagccaccttcctcgtcacgtttggaaactcagagaaacctgaaactatgacttgtcgtctttccaataaccagagatacttgtttctggatggagacagccactatgaaatcgaaattgtacacatttccaccgtgcagatcctcacagaaggcttccctcctggaggaggcaacgcacgggccacaggcatgttcctgcagtatacagtgccggggacggagggtgtgacccagctgaagctgacagtggtggaggacgtgactgtgggcaggaggcaggcggtggcgtggctagtggccatgcacaaggctgccaagctcctctatgaatctcgggaccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 166
- coatomer protein complex, subunit epsilon
- polymerase (RNA) I polypeptide E, 53kDa
- coatomer protein complex, subunit beta 1

Buy ZFYVE21-zinc finger, FYVE domain containing 21 Gene now

Add to cart