RAB7L1-RAB7, member RAS oncogene family-like 1 Gene View larger

RAB7L1-RAB7, member RAS oncogene family-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB7L1-RAB7, member RAS oncogene family-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB7L1-RAB7, member RAS oncogene family-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002585
Product type: DNA & cDNA
Ncbi symbol: RAB7L1
Origin species: Human
Product name: RAB7L1-RAB7, member RAS oncogene family-like 1 Gene
Size: 2ug
Accessions: BC002585
Gene id: 8934
Gene description: RAB7, member RAS oncogene family-like 1
Synonyms: RAB7L1; RAB7L; ras-related protein Rab-7L1; RAB7, member RAS oncogene family-like 1; rab-7-like protein 1; ras-related protein Rab-29; RAB29, member RAS oncogene family
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagccgcgaccacctgttcaaagtgctggtggtgggggacgccgcagtgggcaagacgtcgctggtgcagcgatattcccaggacagcttcagcaaacactacaagtccacggtgggagtggattttgctctgaaggttctccagtggtctgactacgagatagtgcggcttcagctgtgggatattgcagggcaggagcgcttcacctctatgacacgattgtattatcgggatgcctctgcctgtgttattatgtttgacgttaccaatgccactaccttcagcaacagccagaggtggaaacaggacctagacagcaagctcacactacccaatggagagccggtgccctgcctgctcttggccaacaagtgtgatctgtccccttgggcagtgagccgggaccagattgaccggttcagtaaagagaacggtttcacaggttggacagaaacatcagtcaaggagaacaaaaatattaatgaggctatgagagtcctcattgaaaagatgatgagaaattccacagaagatatcatgtctttgtccacccaaggggactacatcaatctacaaaccaagtcctccagctggtcctgctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 179
- hypoxanthine phosphoribosyltransferase 1
- isopentenyl-diphosphate delta isomerase 1
- isopentenyl-diphosphate delta isomerase 1

Buy RAB7L1-RAB7, member RAS oncogene family-like 1 Gene now

Add to cart