Login to display prices
Login to display prices
TM4SF18-transmembrane 4 L six family member 18 Gene View larger

TM4SF18-transmembrane 4 L six family member 18 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM4SF18-transmembrane 4 L six family member 18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TM4SF18-transmembrane 4 L six family member 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014339
Product type: DNA & cDNA
Ncbi symbol: TM4SF18
Origin species: Human
Product name: TM4SF18-transmembrane 4 L six family member 18 Gene
Size: 2ug
Accessions: BC014339
Gene id: 116441
Gene description: transmembrane 4 L six family member 18
Synonyms: L6D; transmembrane 4 L6 family member 18; transmembrane 4 L six family member 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtctcggaagtgtggaggctgcctaagttgtttgctgattccgcttgcactttggagtataatcgtgaacatattattgtatttcccgaatgggcaaacttcctatgcatccagcaataaactcaccaactacgtgtggtattttgaaggaatctgtttctcaggcatcatgatgcttatagtaacaacagttcttctggtactggagaataataacaactataaatgttgccagagtgaaaactgcagcaaaaaatatgtgacactgctgtcaattatcttttcttccctcggaattgctttttctggatactgcctggtcatctctgccttgggtcttgtccaagggccatattgccgcacccttgatggctgggagtatgcttttgaaggcactgctggacgtttccttacagattctagcatatggattcagtgcctggaacctgcacatgttgtggagtggaacatcattttattttccattctcataaccctcagtgggcttcaagtgatcatctgcctcatcagagtagtcatgcaactatccaagatactgtgtggaagctattcagtgatcttccagcctggaatcatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 3, member B
- RAB7, member RAS oncogene family-like 1
- chromosome 14 open reading frame 179
- hypoxanthine phosphoribosyltransferase 1