PEA15-phosphoprotein enriched in astrocytes 15 Gene View larger

PEA15-phosphoprotein enriched in astrocytes 15 Gene

PTXBC002426

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEA15-phosphoprotein enriched in astrocytes 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEA15-phosphoprotein enriched in astrocytes 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002426
Product type: DNA & cDNA
Ncbi symbol: PEA15
Origin species: Human
Product name: PEA15-phosphoprotein enriched in astrocytes 15 Gene
Size: 2ug
Accessions: BC002426
Gene id: 8682
Gene description: phosphoprotein enriched in astrocytes 15
Synonyms: HMAT1; HUMMAT1H; MAT1; MAT1H; PEA-15; PED; astrocytic phosphoprotein PEA-15; 15 kDa phosphoprotein enriched in astrocytes; homolog of mouse MAT-1 oncogene; mammary transforming gene 1, mouse, homolog of; phosphoprotein enriched in diabetes; phosphoprotein enriched in astrocytes 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagtacgggaccctcctgcaagacctgaccaacaacatcacccttgaagatctagaacagctcaagtcggcctgcaaggaagacatccccagcgaaaagagtgaggagatcactactggcagtgcctggtttagcttcctggagagccacaacaagctggacaaagacaacctctcctacattgagcacatctttgagatctcccgccgtcctgacctactcactatggtggttgactacagaacccgtgtgctgaagatctctgaggaggatgagctggacaccaagctaacccgtatccccagtgccaagaagtacaaagacattatccggcagccctctgaggaagagatcatcaaattggctcccccaccgaagaaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 159
- cutC copper transporter homolog (E. coli)
- transmembrane 4 L six family member 18
- C-type lectin domain family 3, member B

Buy PEA15-phosphoprotein enriched in astrocytes 15 Gene now

Add to cart