Login to display prices
Login to display prices
C14orf159-chromosome 14 open reading frame 159 Gene View larger

C14orf159-chromosome 14 open reading frame 159 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf159-chromosome 14 open reading frame 159 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf159-chromosome 14 open reading frame 159 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009182
Product type: DNA & cDNA
Ncbi symbol: C14orf159
Origin species: Human
Product name: C14orf159-chromosome 14 open reading frame 159 Gene
Size: 2ug
Accessions: BC009182
Gene id: 80017
Gene description: chromosome 14 open reading frame 159
Synonyms: UPF0317 protein C14orf159, mitochondrial; chromosome 14 open reading frame 159
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccttcacactccacctgaggtcccgccttccctctgccataaggagtttgattctacaaaagaaaccaaacatcagaaatacatccagcatggctggagagctccgaccagccagcctggtggtcctgcccaggtcccttgctccagcttttgaaagattctgccaggtcaacactggtcctctacccctgctgggccagagtgagccagaaaagtggatgctgccccctcaaggtgctatctcagagaccagcctcagggaccttcacagtgcctggcacagaacctcactcatgactgttgctcaggaacgagctgccctccccactgttctgactccttcccctatcacctggcgcctgtcctggctgagatctttgagatcatggagaaagtccagccctggagaaatcccactggctctgccatctgtccactccatcgcccaagccagaaacccgcctgtacaggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cutC copper transporter homolog (E. coli)
- transmembrane 4 L six family member 18
- C-type lectin domain family 3, member B
- RAB7, member RAS oncogene family-like 1