Login to display prices
Login to display prices
MCHR1-melanin-concentrating hormone receptor 1 Gene View larger

MCHR1-melanin-concentrating hormone receptor 1 Gene

PTXBC001736

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCHR1-melanin-concentrating hormone receptor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MCHR1-melanin-concentrating hormone receptor 1 Gene

Proteogenix catalog: PTXBC001736
Ncbi symbol: MCHR1
Product name: MCHR1-melanin-concentrating hormone receptor 1 Gene
Size: 2ug
Accessions: BC001736
Gene id: 2847
Gene description: melanin-concentrating hormone receptor 1
Synonyms: GPR24; MCH-1R; MCH1R; SLC-1; SLC1; melanin-concentrating hormone receptor 1; G protein-coupled receptor 24; MCH receptor 1; somatostatin receptor-like protein; melanin concentrating hormone receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctcggttgtgggagcaggcgaccggcactggctggatggacctggaagcctcgctgctgcccactggtcccaatgccagcaacacctctgatggccccgataacctcacttcggcaggatcacctcctcgcacggggagcatctcctacatcaacatcatcatgccttcggtgttcggcaccatctgcctcctgggcatcatcgggaactccacggtcatcttcgcggtcgtgaagaagtccaagctgcactggtgcaacaacgtccccgacatcttcatcatcaacctctcggtagtagatctcctctttctcctgggcatgcccttcatgatccaccagctcatgggcaatggggtgtggcactttggggagaccatgtgcaccctcatcacggccatggatgccaatagtcagttcaccagcacctacatcctgaccgccatggccattgaccgctacctggccactgtccaccccatctcttccacgaagttccggaagccctctgtggccaccctggtgatctgcctcctgtgggccctctccttcatcagcatcacccctgtgtggctgtatgccagactcatccccttcccaggaggtgcagtgggctgcggcatacgcctgcccaacccagacactgacctctactggttcaccctgtaccagtttttcctggcctttgccctgccttttgtggtcatcacagccgcatacgtgaggatcctgcagcgcatgacgtcctcagtggcccccgcctcccagcgcagcatccggctgcggacaaagagggtgacccgcacagccatcgccatctgtctggtcttctttgtgtgctgggcaccctactatgtgctacagctgacccagttgtccatcagccgcccgaccctcacctttgtctacttatacaatgcggccatcagcttgggctatgccaacagctgcctcaacccctttgtgtacatcgtgctctgtgagacgttccgcaaacgcttggtcctgtcggtgaagcctgcagcccaggggcagcttcgcgctgtcagcaacgctcagacggctgacgaggagaggacagaaagcaaaggcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: