VIPR2-vasoactive intestinal peptide receptor 2 Gene View larger

VIPR2-vasoactive intestinal peptide receptor 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VIPR2-vasoactive intestinal peptide receptor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VIPR2-vasoactive intestinal peptide receptor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010569
Product type: DNA & cDNA
Ncbi symbol: VIPR2
Origin species: Human
Product name: VIPR2-vasoactive intestinal peptide receptor 2 Gene
Size: 2ug
Accessions: BC010569
Gene id: 7434
Gene description: vasoactive intestinal peptide receptor 2
Synonyms: C16DUPq36.3; DUP7q36.3; PACAP-R-3; PACAP-R3; VIP-R-2; VPAC2; VPAC2R; VPCAP2R; vasoactive intestinal polypeptide receptor 2; PACAP type III receptor; VIP and PACAP receptor 2; helodermin-preferring VIP receptor; pituitary adenylate cyclase-activating polypeptide type III receptor; vasoactive intestinal peptide receptor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggacgctgctgcctcccgcgctgctgacctgctggctgctcgcccccgtgaacagcattcacccagaatgccgatttcatctggaaatacaggaggaagaaacaaaatgtgcagagcttctgaggtctcaaacagaaaaacacaaagcctgcagtggcgtctgggacaacatcacgtgctggcggcctgccaatgtgggagagaccgtcacggtgccctgcccaaaagtcttcagcaatttttacagcaaagcaggaaacataagcaaaaactgtacgagtgacggatggtcagagacgttcccagatttcgtcgatgcctgtggctacagcgacccggaggatgagagcaagatcacgttttatattctggtgaaggccatttataccctgggctacagtgtctctctgatgtctcttgcaacaggaagcataattctgtgcctcttcaggaagctgcactgcaccaggaattacatccacctgaacctgttcctgtccttcatcctgagagccatctcagtgctggtcaaggacgacgttctctactccagctctggcacgttgcactgccctgaccagccatcctcctgggtgggctgcaagctgagcctggtcttcctgcagtactgcatcatggccaacttcttctggctgctggtggaggggctctacctccacaccctcctggtggccatgctcccccctagaaggtgcttcctggcctacctcctgatcggatggggcctccccaccgtctgcatcggtgcatggactgcggccaggctctacttagaagacaccggttgctgggatacaaacgaccacagtgtgccctggtgggtcatacgaataccgattttaatttccatcatcgtcaattttgtccttttcattagtattatacgaattttgctgcagaagttaacatccccagatgtcggcggcaacgaccagtctcagtacaagaggctggccaagtccacgctcctgcttatcccgctgttcggcgtccactacatggtgtttgccgtgtttcccatcagcatctcctccaaataccagatactgtttgagctgtgcctcgggtcgttccagggcctggtggtggccgtcctctactgtttcctgaacagtgaggtgcagtgcgagctgaagcgaaaatggcgaagccggtgcccgaccccgtccgcgagccgggattacagggtctgcggttcctccttctcccgcaacggctcggagggcgccctgcagttccaccgcggctcccgcgcccagtccttcctgcaaacggagacctcggtcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 114
- arginyl-tRNA synthetase 2, mitochondrial
- acetylserotonin O-methyltransferase-like
- chromosome 17 open reading frame 101

Buy VIPR2-vasoactive intestinal peptide receptor 2 Gene now

Add to cart