GALT-galactose-1-phosphate uridylyltransferase Gene View larger

GALT-galactose-1-phosphate uridylyltransferase Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GALT-galactose-1-phosphate uridylyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GALT-galactose-1-phosphate uridylyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015045
Product type: DNA & cDNA
Ncbi symbol: GALT
Origin species: Human
Product name: GALT-galactose-1-phosphate uridylyltransferase Gene
Size: 2ug
Accessions: BC015045
Gene id: 2592
Gene description: galactose-1-phosphate uridylyltransferase
Synonyms: galactose-1-phosphate uridylyltransferase; UDP-glucose--hexose-1-phosphate uridylyltransferase; gal-1-P uridylyltransferase; galactose-1-phosphate uridyl transferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcgcagtggaaccgatcctcagcaacgccagcaggcgtcagaggcggacgccgcagcagcaaccttccgggcaaacgaccatcagcatatccgctacaacccgctgcaggatgagtgggtgctggtgtcagctcaccgcatgaagcggccctggcagggtcaagtggagccccagcttctgaagacagtgccccgccatgaccctctcaaccctctgtgtcctggggccatccgagccaacggagaggtgaatccccagtacgatagcaccttcctgtttgacaacgacttcccagctctgcagcctgatgcccccagtccaggacccagtgatcatccccttttccaagcaaagtctgctcgaggagtctgtaaggtcatgtgcttccacccctggtcggatgtaacgctgccactcatgtcggtccctgagatccgggctgttgttgatgcatgggcctcagtcacagaggagctgggtgcccagtacccttgggtgcagatctttgaaaacaaaggtgccatgatgggctgttctaacccccacccccactgccaggtatgggccagcagtttcctgccagatattgcccagcgtgaggagcgatctcagcaggcctataagagtcagcatggagagcccctgctaatggagtacagccgccaggagctactcaggaaggaacgtctggtcctaaccagtgagcactggttagtactggtccccttctgggcaacatggccctaccagacactgctgctgccccgtcggcatgtgcggcggctacctgagctgacccctgctgagcgtgatgatctagcctccatcatgaagaagctcttgaccaagtatgacaacctctttgagacgtcctttccctactccatgggctggcatggggctcccacaggatcagaggctggggccaactgggaccattggcagctgcacgctcattactaccctccgctcctgcgctctgccactgtccggaaattcatggttggctacgaaatgcttgctcaggctcagagggacctcacccctgagcaggctgcagagagactaagggcacttcctgaggttcattaccacctggggcagaaggacagggagacagcaaccatcgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanin-concentrating hormone receptor 1
- vasoactive intestinal peptide receptor 2
- chromosome 20 open reading frame 114
- arginyl-tRNA synthetase 2, mitochondrial

Buy GALT-galactose-1-phosphate uridylyltransferase Gene now

Add to cart