Login to display prices
Login to display prices
CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene View larger

CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene

PTXBC024196

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene

Proteogenix catalog: PTXBC024196
Ncbi symbol: CIAPIN1
Product name: CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene
Size: 2ug
Accessions: BC024196
Gene id: 57019
Gene description: cytokine induced apoptosis inhibitor 1
Synonyms: Anamorsin; DRE2; PRO0915; fe-S cluster assembly protein DRE2 homolog; cytokine induced apoptosis inhibitor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagattttgggatctctgctggccagtttgtggcagtggtctgggataagtcatccccagtggaggctctgaaaggtctggtggataagcttcaagcgttaaccggcaatgagggccgcgtgtctgtggaaaacatcaagcagctgttgcaatctgcccacaaagaatccagctttgacattattttgtcaggtttagtcccaggaagcaccactctgcacagtgctgagattttggctgaaatcgcccggatccttcggcctggtggatgtctttttctgaaggagccagtagagacagctgtagataacaatagcaaagtgaagacagcatctaagctgtgttcagccctgactctttctggtcttgtggaagtgaaagagctgcagcgggagcccctaacccctgaggaagtacagtctgttcgagaacaccttggtcatgaaagtgacaacctgctgtttgttcagatcacaggcaaaaaaccaaactttgaagtgggttcttctaggcagcttaagctttccatcaccaagaagtcttctccttcagtgaaacctgctgtggaccctgctgctgccaagctgtggaccctctcagccaacgatatggaggacgacagcatggatctcattgactcagatgagctgctggatccagaagatttgaagaagccagatccagcttccctgcgggctgcttcttgtggggaagggaaaaagaggaaggcctgtaagaactgcacctgtggccttgccgaagaactggaaaaagagaagtcaagggaacagatgagctcccaaccaaagtcagcttgtggaaactgctacctgggcgatgccttccgctgtgccagctgcccctaccttgggatgccagccttcaaacctggggaaaaggtgcttctgagtgatagcaatcttcatgatgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: