Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene
PTXBC009605
New product
Data sheet of RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009605 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAC3 |
| Origin species: | Human |
| Product name: | RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene |
| Size: | 2ug |
| Accessions: | BC009605 |
| Gene id: | 5881 |
| Gene description: | ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) |
| Synonyms: | ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3); rho family, small GTP binding protein Rac3; p21-Rac3; ras-related C3 botulinum toxin substrate 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggccatcaagtgcgtggtggtcggcgacggcgccgtggggaagacatgcttgctgatcagctacacgaccaacgccttccccggagagtacatccccaccgtttttgacaactactctgccaacgtgatggtggacgggaaaccagtcaacttggggctgtgggacacagcgggtcaggaggactacgatcggctgcggccactctcctacccccaaactgacgtctttctgatctgcttctctctggtgagcccggcctccttcgagaatgttcgtgccaagtggtacccggaggtgcggcaccactgcccccacacgcccatcctcctggtgggcaccaagctggacctccgcgacgacaaggacaccattgagcggctgcgggacaagaagctggcacccatcacctacccacagggcctggccatggcccgggagattggctctgtgaaatacctggagtgctcagccctgacccagcggggcctgaagacagtgtttgacgaggcgatccgcgcggtgctctgcccgcccccagtgaagaagccggggaagaagtgcaccgtcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 - CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 |