RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene View larger

RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009605
Product type: DNA & cDNA
Ncbi symbol: RAC3
Origin species: Human
Product name: RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene
Size: 2ug
Accessions: BC009605
Gene id: 5881
Gene description: ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Synonyms: ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3); rho family, small GTP binding protein Rac3; p21-Rac3; ras-related C3 botulinum toxin substrate 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggccatcaagtgcgtggtggtcggcgacggcgccgtggggaagacatgcttgctgatcagctacacgaccaacgccttccccggagagtacatccccaccgtttttgacaactactctgccaacgtgatggtggacgggaaaccagtcaacttggggctgtgggacacagcgggtcaggaggactacgatcggctgcggccactctcctacccccaaactgacgtctttctgatctgcttctctctggtgagcccggcctccttcgagaatgttcgtgccaagtggtacccggaggtgcggcaccactgcccccacacgcccatcctcctggtgggcaccaagctggacctccgcgacgacaaggacaccattgagcggctgcgggacaagaagctggcacccatcacctacccacagggcctggccatggcccgggagattggctctgtgaaatacctggagtgctcagccctgacccagcggggcctgaagacagtgtttgacgaggcgatccgcgcggtgctctgcccgcccccagtgaagaagccggggaagaagtgcaccgtcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4
- CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
- nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3

Buy RAC3-ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Gene now

Add to cart