No products
Prices are tax excluded
PTXBC034554
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034554 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINA3 |
| Origin species: | Human |
| Product name: | SERPINA3-serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 Gene |
| Size: | 2ug |
| Accessions: | BC034554 |
| Gene id: | 12 |
| Gene description: | serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 |
| Synonyms: | AACT; ACT; GIG24; GIG25; alpha-1-antichymotrypsin; cell growth-inhibiting gene 24/25 protein; growth-inhibiting protein 24; growth-inhibiting protein 25; serine (or cysteine) proteinase inhibitor, clade A, member 3; serpin A3; serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3; serpin family A member 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagagaatgttacctctcctggctctggggctcttggcggctgggttctgccctgctgtcctctgccaccctaacagcccacttgacgaggagaatctgacccaggagaaccaagaccgagggacacacgtggacctcggattagcctccgccaacgtggacttcgctttcagcctgtacaagcagttagtcctgaaggcccctgataagaatgtcatcttctccccactgagcatctccaccgccttggccttcctgtctctgggggcccataataccaccctgacagagattctcaaaggcctcaagttcaacctcacggagacttctgaggcagaaattcaccagagcttccagcacctcctgcgcaccctcaatcagtccagcgatgagctgcagctgagtatgggaaatgccatgtttgtcaaagagcaactcagtctgctggacaggttcacggaggatgccaagaggctgtatggctccgaggcctttgccactgactttcaggactcagctgcagctaagaagctcatcaacgactacgtgaagaatggaactagggggaaaatcacagatctgatcaaggaccttgactcgcagacaatgatggtcctggtgaattacatcttctttaaagccaaatgggagatgccctttgacccccaagatactcatcagtcaaggttctacttgagcaagaaaaagtgggtaatggtgcccatgatgagtttgcatcacctgactataccttacttccgggacgaggagctgtcctgcaccgtggtggagctgaggtacacaggcaatgccagcgcactcttcatcctccctgatcaagacaagatggaggaagtggaagccatgctgctcccagagaccctgaagcggtggagagactctctggagttcagagagataggtgagctctacctgccaaagttttccatctcgagggactataacctgaacgacatacttctccagctgggcattgaggaagccttcaccagcaaggctgacctgtcagggatcacaggggccaggaacctagcagtctcccaggtggtccataaggctgtgcttgatgtatttgaggagggcacagaagcatctgctgccacagcagtcaaaatcaccctcctttctgcattagtggagacaaggaccattgtgcgtttcaacaggcccttcctgatgatcattgtccctacagacacccagaacatcttcttcatgagcaaagtcaccaatcccaagcaagcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 - ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) |