Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RAC1-ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) Gene
PTXBC004247
New product
Data sheet of RAC1-ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAC1-ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004247 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAC1 |
| Origin species: | Human |
| Product name: | RAC1-ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) Gene |
| Size: | 2ug |
| Accessions: | BC004247 |
| Gene id: | 5879 |
| Gene description: | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) |
| Synonyms: | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1); p21-Rac1; MIG5; Rac-1; TC-25; ras-related C3 botulinum toxin substrate 1; cell migration-inducing gene 5 protein; ras-like protein TC25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggccatcaagtgtgtggtggtgggagacggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatccctactgtctttgacaattattctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagctggacaagaagattatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttgtgagtcctgcatcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatcatcctagtgggaactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgattcccatcacctatccgcagggtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacacagcgaggcctcaagacagtgtttgacgaagcgatccgagcagtcctctgcccgcctcccgtgaagaagaggaagagaaaatgcctgctgttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - excision repair cross-complementing rodent repair deficiency, complementation group 2 - amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein - butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1 - tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) |