APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene View larger

APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene

PTXBC035636

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035636
Product type: DNA & cDNA
Ncbi symbol: APBB1IP
Origin species: Human
Product name: APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene
Size: 2ug
Accessions: BC035636
Gene id: 54518
Gene description: amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Synonyms: INAG1; PREL1; RARP1; RIAM; amyloid beta A4 precursor protein-binding family B member 1-interacting protein; APBB1-interacting protein 1; PREL-1; RARP-1; Rap1-GTP-interacting adaptor molecule; Rap1-interacting adaptor molecule; proline rich EVH1 ligand 1; proline-rich protein 73; rap1-GTP-interacting adapter molecule; retinoic acid-responsive proline-rich protein 1; amyloid beta precursor protein binding family B member 1 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgagtcaagtgaagacatagaccaaatgttcagcactttgctgggagagatggatcttctgactcagagtttaggagttgacactctccctcctcctgaccctaatccacccagagctgaatttaactacagtgtggggtttaaagatttaaatgagtccttaaatgcactggaagaccaagatttagatgctctcatggcagatctggtagcagacataagtgaggctgagcagaggacaatccaggcacagaaagagtccttgcagaatcaacatcattcagcatctctacaagcatcaattttcagtggtgcagcctctcttggttatggaacaaatgttgctgccactggtatcagccaatatgaggatgacttaccacctccaccagccgatcctgtgttagaccttccactgccaccaccacctcctgaacctctctctcaggtaagtatgtgggaccagagatggcaggaccatcaacctctgctacctatcactgatgttccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
- tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
- prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
- interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)

Buy APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene now

Add to cart