Login to display prices
Login to display prices
PTGS2-prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) Gene View larger

PTGS2-prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) Gene

PTXBC013734

New product

Data sheet of PTGS2-prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTGS2-prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC013734
Ncbi symbol: PTGS2
Product name: PTGS2-prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) Gene
Size: 2ug
Accessions: BC013734
Gene id: 5743
Gene description: prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Synonyms: COX-2; COX2; GRIPGHS; PGG/HS; PGHS-2; PHS-2; hCox-2; prostaglandin G/H synthase 2; PGH synthase 2; PHS II; cyclooxygenase 2; cyclooxygenase 2b; prostaglandin H2 synthase 2; prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase); prostaglandin-endoperoxide synthase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcgcccgcgccctgctgctgtgcgcggtcctggcgctcagccatacagcaaatccttgctgttcccacccatgtcaaaaccgaggtgtatgtatgagtgtgggatttgaccagtataagtgcgattgtacccggacaggattctatggagaaaactgctcaacaccggaatttttgacaagaataaaattatttctgaaacccactccaaacacagtgcactacatacttacccacttcaagggattttggaacgttgtgaataacattcccttccttcgaaatgcaattatgagttatgtgttgacatccagatcacatttgattgacagtccaccaacttacaatgctgactatggctacaaaagctgggaagccttctctaacctctcctattatactagagcccttcctcctgtgcctgatgattgcccgactcccttgggtgtcaaaggtaaaaagcagcttcctgattcaaatgagattgtggaaaaattgcttctaagaagaaagttcatccctgatccccagggctcaaacatgatgtttgcattctttgcccagcacttcacgcatcagtttttcaagacagatcataagcgagggccagctttcaccaacgggctgggccatggggtggacttaaatcatatttacggtgaaactctggctagacagcgtaaactgcgccttttcaaggatggaaaaatgaaatatcagataattgatggagagatgtatcctcccacagtcaaagatactcaggcagagatgatctaccctcctcaagtccctgagcatctacggtttgctgtggggcaggaggtctttggtctggtgcctggtctgatgatgtatgccacaatctggctgcgggaacacaacagagtatgcgatgtgcttaaacaggagcatcctgaatggggtgatgagcagttgttccagacaagcaggctaatactgataggagagactattaagattgtgattgaagattatgtgcaacacttgagtggctatcacttcaaactgaaatttgacccagaactacttttcaacaaacaattccagtaccaaaatcgtattgctgctgaatttaacaccctctatcactggcatccccttctgcctgacacctttcaaattcatgaccagaaatacaactatcaacagtttatctacaacaactctatattgctggaacatggaattacccagtttgttgaatcattcaccaggcaaattgctggcagggttgctggtggtaggaatgttccacccgcagtacagaaagtatcacaggcttccattgaccagagcaggcagatgaaataccagtcttttaatgagtaccgcaaacgctttatgctgaagccctatgaatcatttgaagaacttacaggagaaaaggaaatgtctgcagagttggaagcactctatggtgacatcgatgctgtggagctgtatcctgcccttctggtagaaaagcctcggccagatgccatctttggtgaaaccatggtagaagttggagcaccattctccttgaaaggacttatgggtaatgttatatgttctcctgcctactggaagccaagcacttttggtggagaagtgggttttcaaatcatcaacactgcctcaattcagtctctcatctgcaataacgtgaagggctgtccctttacttcattcagtgttccagatccagagctcattaaaacagtcaccatcaatgcaagttcttcccgctccggactagatgatatcaatcccacagtactactaaaagaacgttcgactgaactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: